Incidental Mutation 'R4720:Azin1'
ID354405
Institutional Source Beutler Lab
Gene Symbol Azin1
Ensembl Gene ENSMUSG00000037458
Gene Nameantizyme inhibitor 1
SynonymsODC antizyme inhibitor, Oazi, Oazin, 1700085L02Rik
MMRRC Submission 041958-MU
Accession Numbers

Genbank: NM_018745; MGI: 1859169

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location38487427-38519266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38493500 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 293 (V293A)
Ref Sequence ENSEMBL: ENSMUSP00000105958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000129589]
Predicted Effect probably benign
Transcript: ENSMUST00000065308
AA Change: V293A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: V293A

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.2e-66 PFAM
Pfam:Orn_DAP_Arg_deC 282 406 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110328
SMART Domains Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 9.4e-67 PFAM
Pfam:Orn_DAP_Arg_deC 282 357 7.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110329
AA Change: V293A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: V293A

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 279 5.4e-69 PFAM
Pfam:Orn_DAP_Arg_deC 283 405 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129589
SMART Domains Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 154 1.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226152
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,127,422 I1124T probably damaging Het
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Acvrl1 C A 15: 101,135,773 P112Q probably damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Helz2 T C 2: 181,238,417 D502G probably damaging Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il1rl1 A G 1: 40,446,678 K330E probably benign Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kcnq5 C T 1: 21,403,050 A630T probably damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Nvl A G 1: 181,101,587 L743P probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Prkdc T A 16: 15,667,715 S469T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rims1 A G 1: 22,427,481 Y808H probably damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Azin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Azin1 APN 15 38493486 missense probably benign
IGL02406:Azin1 APN 15 38491565 missense probably benign 0.00
H2330:Azin1 UTSW 15 38497276 missense probably damaging 0.98
R0562:Azin1 UTSW 15 38493581 missense probably benign 0.00
R3416:Azin1 UTSW 15 38493546 missense possibly damaging 0.89
R3434:Azin1 UTSW 15 38493576 missense probably benign 0.00
R3978:Azin1 UTSW 15 38498713 missense probably damaging 0.99
R4535:Azin1 UTSW 15 38493605 missense probably benign 0.11
R5266:Azin1 UTSW 15 38491551 missense probably benign
R6416:Azin1 UTSW 15 38492343 missense possibly damaging 0.71
R7242:Azin1 UTSW 15 38501505 start codon destroyed probably null 1.00
R7283:Azin1 UTSW 15 38501408 missense probably damaging 0.98
R7577:Azin1 UTSW 15 38501421 missense probably benign 0.01
R7604:Azin1 UTSW 15 38491634 missense probably damaging 1.00
R8221:Azin1 UTSW 15 38492328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAATTGGTCTGACGCTCTAG -3'
(R):5'- TCCCTGCTAGGTTGGAATTG -3'

Sequencing Primer
(F):5'- TGGTCTGACGCTCTAGTAAAGTAAG -3'
(R):5'- CCCTGCTAGGTTGGAATTGAATAG -3'
Posted On2015-10-21