Incidental Mutation 'R4720:Acvrl1'
ID354408
Institutional Source Beutler Lab
Gene Symbol Acvrl1
Ensembl Gene ENSMUSG00000000530
Gene Nameactivin A receptor, type II-like 1
SynonymsAlk-1, activin receptor-like kinase-1, Alk1, Acvrlk1
MMRRC Submission 041958-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101128522-101145336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101135773 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 112 (P112Q)
Ref Sequence ENSEMBL: ENSMUSP00000114027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000542] [ENSMUST00000117984] [ENSMUST00000119063] [ENSMUST00000120028] [ENSMUST00000120754] [ENSMUST00000121718] [ENSMUST00000124151] [ENSMUST00000130432] [ENSMUST00000144229]
Predicted Effect probably damaging
Transcript: ENSMUST00000000542
AA Change: P112Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000542
Gene: ENSMUSG00000000530
AA Change: P112Q

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117984
AA Change: P112Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113505
Gene: ENSMUSG00000000530
AA Change: P112Q

DomainStartEndE-ValueType
PDB:2LCR|A 19 116 4e-43 PDB
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000119063
AA Change: P112Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113536
Gene: ENSMUSG00000000530
AA Change: P112Q

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120028
AA Change: P112Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113297
Gene: ENSMUSG00000000530
AA Change: P112Q

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000120754
AA Change: P112Q

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112490
Gene: ENSMUSG00000000530
AA Change: P112Q

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000121718
AA Change: P112Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114027
Gene: ENSMUSG00000000530
AA Change: P112Q

DomainStartEndE-ValueType
Pfam:Activin_recp 31 102 2.1e-10 PFAM
low complexity region 118 139 N/A INTRINSIC
GS 171 201 5.72e-14 SMART
Blast:TyrKc 207 478 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124151
SMART Domains Protein: ENSMUSP00000114829
Gene: ENSMUSG00000000530

DomainStartEndE-ValueType
PDB:2LCR|A 19 76 8e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128868
Predicted Effect probably benign
Transcript: ENSMUST00000130432
Predicted Effect probably benign
Transcript: ENSMUST00000144229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153253
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene die at midgestation with severe vascular abnormalities, including fusion of major arteries and veins. Mice heterozygous for one targeted mutation provide a suitable model for hereditary hemorrhagic telangiectasia type 2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,127,422 I1124T probably damaging Het
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Azin1 A G 15: 38,493,500 V293A probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Helz2 T C 2: 181,238,417 D502G probably damaging Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il1rl1 A G 1: 40,446,678 K330E probably benign Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kcnq5 C T 1: 21,403,050 A630T probably damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Nvl A G 1: 181,101,587 L743P probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Prkdc T A 16: 15,667,715 S469T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rims1 A G 1: 22,427,481 Y808H probably damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Acvrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Acvrl1 APN 15 101143340 splice site probably null
IGL00780:Acvrl1 APN 15 101137367 missense probably damaging 1.00
IGL01714:Acvrl1 APN 15 101137370 missense probably damaging 1.00
IGL02962:Acvrl1 APN 15 101135501 missense probably benign 0.00
IGL03268:Acvrl1 APN 15 101135922 missense possibly damaging 0.48
IGL03341:Acvrl1 APN 15 101137596 missense probably damaging 1.00
R0256:Acvrl1 UTSW 15 101137121 missense probably damaging 1.00
R0538:Acvrl1 UTSW 15 101136149 missense probably damaging 0.99
R1666:Acvrl1 UTSW 15 101137577 missense probably damaging 1.00
R2402:Acvrl1 UTSW 15 101137399 missense probably damaging 1.00
R3789:Acvrl1 UTSW 15 101137469 missense probably damaging 0.98
R4844:Acvrl1 UTSW 15 101135528 missense probably damaging 0.98
R4995:Acvrl1 UTSW 15 101135860 missense probably benign 0.00
R5053:Acvrl1 UTSW 15 101137369 missense probably damaging 1.00
R5093:Acvrl1 UTSW 15 101134747 splice site probably null
R5191:Acvrl1 UTSW 15 101137065 missense probably damaging 0.99
R6981:Acvrl1 UTSW 15 101138345 missense probably damaging 1.00
R7224:Acvrl1 UTSW 15 101143364 missense probably benign 0.17
R7231:Acvrl1 UTSW 15 101136223 nonsense probably null
R7326:Acvrl1 UTSW 15 101141072 missense probably damaging 0.97
R7555:Acvrl1 UTSW 15 101143473 missense probably benign 0.05
R7569:Acvrl1 UTSW 15 101135755 missense probably benign 0.00
R7627:Acvrl1 UTSW 15 101135866 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACAACGTGTCTCTGATGCTG -3'
(R):5'- CCTGTTCAGATGCCTTCAGG -3'

Sequencing Primer
(F):5'- AGGGTATGTCAGGTGGCTCAC -3'
(R):5'- TTCAGATGCCTTCAGGATGAGAC -3'
Posted On2015-10-21