Incidental Mutation 'R4720:Prkdc'
ID354409
Institutional Source Beutler Lab
Gene Symbol Prkdc
Ensembl Gene ENSMUSG00000022672
Gene Nameprotein kinase, DNA activated, catalytic polypeptide
Synonymsslip, DOXNPH, DNA-PKcs, XRCC7, dxnph, DNA-PK, DNAPDcs
MMRRC Submission 041958-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4720 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location15637866-15842235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15667715 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 469 (S469T)
Ref Sequence ENSEMBL: ENSMUSP00000023352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023352]
Predicted Effect probably benign
Transcript: ENSMUST00000023352
AA Change: S469T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023352
Gene: ENSMUSG00000022672
AA Change: S469T

DomainStartEndE-ValueType
low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
NUC194 1810 2206 2.37e-246 SMART
SCOP:d1gw5a_ 2210 2493 5e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 8.2e-75 PFAM
PI3Kc 3749 4068 3.67e-86 SMART
FATC 4096 4128 1.57e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182134
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of the DNA-dependent protein kinase (DNA-PK). It functions with the Ku70/Ku80 heterodimer protein in DNA double strand break repair and recombination. The protein encoded is a member of the PI3/PI4-kinase family.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mutations at this locus effect genome stability, radiation sensitivity and DNA repair. Nonsense (scid) and null homozygotes have severe combined immunodeficiency. A BALB/c variant allele reduces enzyme activity and predisposes to breast cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,127,422 I1124T probably damaging Het
Acacb A G 5: 114,229,914 T1658A possibly damaging Het
Acvrl1 C A 15: 101,135,773 P112Q probably damaging Het
Als2cr12 T C 1: 58,678,348 I135V possibly damaging Het
Ankar A T 1: 72,699,011 I4K possibly damaging Het
Ankfn1 G C 11: 89,441,426 D431E possibly damaging Het
Apobec4 T C 1: 152,756,674 V151A possibly damaging Het
Atp10b A G 11: 43,203,122 S498G probably benign Het
Azin1 A G 15: 38,493,500 V293A probably benign Het
Ccdc88b T C 19: 6,857,715 E46G probably damaging Het
Ccdc96 T C 5: 36,484,875 probably benign Het
Ccnyl1 A G 1: 64,713,131 D169G probably benign Het
Cdca3 T A 6: 124,832,164 V89E probably damaging Het
Cdh19 A T 1: 110,895,381 probably null Het
Chka G A 19: 3,886,375 V238I probably damaging Het
Cntn3 T C 6: 102,242,022 K546E possibly damaging Het
Crybg3 A G 16: 59,539,817 V787A probably damaging Het
Dlgap3 T C 4: 127,195,715 probably null Het
Dnah8 C T 17: 30,683,634 L889F probably benign Het
Dnah9 T C 11: 66,076,358 E1658G probably damaging Het
Dnajc11 A G 4: 151,968,539 D102G probably damaging Het
Dync1i2 T G 2: 71,233,674 S121A probably damaging Het
Ece1 G A 4: 137,957,175 E591K probably damaging Het
Enthd1 G A 15: 80,560,309 S15L probably damaging Het
Epb41l2 T A 10: 25,471,626 H372Q probably damaging Het
Errfi1 T A 4: 150,866,747 Y211N probably damaging Het
Fam193b G A 13: 55,543,437 T208M probably benign Het
Fmnl2 C T 2: 53,107,540 T501M possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm340 G C 19: 41,585,895 A1030P probably benign Het
Gm4841 G T 18: 60,270,063 D319E probably benign Het
Gm5724 C A 6: 141,723,222 A495S probably damaging Het
Gucd1 A G 10: 75,509,660 F187S probably damaging Het
Hcar2 GCGGATGCGCAC GC 5: 123,864,689 probably null Het
Helz2 T C 2: 181,238,417 D502G probably damaging Het
Hspa2 A G 12: 76,404,865 E111G possibly damaging Het
Htr2a T A 14: 74,645,059 S162T probably damaging Het
Ift80 A G 3: 68,962,290 Y223H possibly damaging Het
Il1rl1 A G 1: 40,446,678 K330E probably benign Het
Il23r A T 6: 67,423,661 F562I probably damaging Het
Isx T C 8: 74,873,859 probably null Het
Jcad G A 18: 4,674,055 V606I probably benign Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Kcnq5 C T 1: 21,403,050 A630T probably damaging Het
Kif2c T C 4: 117,171,749 M188V probably benign Het
Kntc1 T C 5: 123,765,023 V321A possibly damaging Het
Krtap4-8 A T 11: 99,780,445 probably benign Het
Lgals3bp A C 11: 118,398,469 L52R probably damaging Het
Lipk C A 19: 34,021,699 H126Q probably damaging Het
Lpgat1 T C 1: 191,763,667 Y323H probably damaging Het
Lrp2 T G 2: 69,481,173 N2654H probably damaging Het
Lsm14b C T 2: 180,027,981 Q6* probably null Het
Lysmd3 C T 13: 81,669,465 A187V possibly damaging Het
Map2k5 A G 9: 63,293,719 S211P probably damaging Het
Mlph A T 1: 90,941,697 I474F probably damaging Het
Mpped2 T C 2: 106,783,746 S142P probably damaging Het
Nemf A C 12: 69,324,288 M678R probably benign Het
Nfe2l1 A T 11: 96,827,689 Y7N probably damaging Het
Nfkbie T G 17: 45,556,306 D122E probably benign Het
Noc3l C A 19: 38,789,622 A783S probably benign Het
Nol8 T C 13: 49,662,753 V761A probably damaging Het
Nvl A G 1: 181,101,587 L743P probably damaging Het
Olfr3 T A 2: 36,812,472 I207F probably benign Het
Plcb1 A G 2: 135,251,747 K160R possibly damaging Het
Plekhg3 G T 12: 76,578,322 G1313C possibly damaging Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Popdc3 G A 10: 45,314,906 V38I probably benign Het
Prdx3 A T 19: 60,870,113 V114D possibly damaging Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Rims1 A G 1: 22,427,481 Y808H probably damaging Het
Rsbn1 C A 3: 103,929,020 T458N possibly damaging Het
Serpina3b A G 12: 104,130,630 S57G possibly damaging Het
Skor2 G T 18: 76,861,183 probably null Het
Slc22a4 A T 11: 53,988,893 Y447N probably damaging Het
Stx19 G T 16: 62,822,319 R166L probably damaging Het
Svep1 T C 4: 58,205,869 T170A possibly damaging Het
Sycp2 T G 2: 178,374,432 S746R probably benign Het
Tchh G T 3: 93,447,882 R1543L unknown Het
Tjp2 T C 19: 24,100,805 D908G probably damaging Het
Ttc8 C A 12: 98,979,809 A452E possibly damaging Het
Unc5a T A 13: 55,003,883 W709R probably null Het
Unc80 T A 1: 66,510,792 S736R possibly damaging Het
Vmn2r100 C A 17: 19,522,526 H387Q probably benign Het
Vmn2r39 C T 7: 9,023,470 probably null Het
Vmn2r88 T A 14: 51,413,245 D138E probably benign Het
Vwce T C 19: 10,648,467 F448L possibly damaging Het
Wdr75 C T 1: 45,822,485 S695F probably benign Het
Zfand4 T C 6: 116,288,161 probably null Het
Zfp511 T A 7: 140,037,511 probably null Het
Zfyve9 T C 4: 108,644,368 K584E possibly damaging Het
Other mutations in Prkdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Prkdc APN 16 15697226 missense probably damaging 1.00
IGL00225:Prkdc APN 16 15809644 missense possibly damaging 0.64
IGL00481:Prkdc APN 16 15790466 missense probably benign 0.41
IGL00488:Prkdc APN 16 15775847 splice site probably null
IGL00489:Prkdc APN 16 15799926 missense possibly damaging 0.51
IGL00579:Prkdc APN 16 15664239 missense probably damaging 1.00
IGL00587:Prkdc APN 16 15652358 splice site probably benign
IGL00666:Prkdc APN 16 15736835 missense probably damaging 1.00
IGL00675:Prkdc APN 16 15787158 missense probably benign 0.05
IGL00708:Prkdc APN 16 15779426 missense probably damaging 0.97
IGL00725:Prkdc APN 16 15816639 missense probably benign 0.10
IGL00818:Prkdc APN 16 15759754 missense possibly damaging 0.92
IGL00917:Prkdc APN 16 15739564 missense probably damaging 0.98
IGL00990:Prkdc APN 16 15702115 missense probably benign 0.03
IGL01126:Prkdc APN 16 15669321 missense probably benign 0.01
IGL01141:Prkdc APN 16 15726704 missense probably damaging 0.99
IGL01306:Prkdc APN 16 15667731 missense possibly damaging 0.67
IGL01326:Prkdc APN 16 15829692 missense probably benign
IGL01335:Prkdc APN 16 15816896 critical splice donor site probably null
IGL01419:Prkdc APN 16 15835166 missense probably damaging 1.00
IGL01434:Prkdc APN 16 15713587 missense probably benign 0.00
IGL01554:Prkdc APN 16 15652302 missense probably benign 0.05
IGL01671:Prkdc APN 16 15667745 missense possibly damaging 0.90
IGL01871:Prkdc APN 16 15783087 missense probably benign 0.00
IGL01874:Prkdc APN 16 15734994 missense possibly damaging 0.89
IGL01930:Prkdc APN 16 15698887 missense probably damaging 1.00
IGL01984:Prkdc APN 16 15708779 missense probably benign
IGL02121:Prkdc APN 16 15717184 missense probably benign 0.18
IGL02152:Prkdc APN 16 15669285 missense probably benign 0.15
IGL02172:Prkdc APN 16 15809759 missense probably benign 0.10
IGL02336:Prkdc APN 16 15785978 missense possibly damaging 0.47
IGL02336:Prkdc APN 16 15785979 missense probably benign 0.01
IGL02393:Prkdc APN 16 15816758 missense probably benign 0.42
IGL02406:Prkdc APN 16 15670535 missense probably benign 0.00
IGL02500:Prkdc APN 16 15714282 critical splice donor site probably null
IGL02568:Prkdc APN 16 15726542 missense probably damaging 0.98
IGL02579:Prkdc APN 16 15670601 missense possibly damaging 0.83
IGL02652:Prkdc APN 16 15783087 missense probably benign 0.00
IGL02661:Prkdc APN 16 15769825 missense possibly damaging 0.92
IGL02685:Prkdc APN 16 15836043 missense possibly damaging 0.61
IGL02741:Prkdc APN 16 15752726 splice site probably benign
IGL02803:Prkdc APN 16 15833666 splice site probably benign
IGL02866:Prkdc APN 16 15831327 missense probably damaging 1.00
IGL02882:Prkdc APN 16 15651519 nonsense probably null
IGL02989:Prkdc APN 16 15800016 missense possibly damaging 0.67
IGL03053:Prkdc APN 16 15834166 missense probably benign 0.02
IGL03071:Prkdc APN 16 15799984 missense probably benign 0.01
IGL03091:Prkdc APN 16 15705310 splice site probably benign
IGL03100:Prkdc APN 16 15713635 missense probably benign 0.08
IGL03128:Prkdc APN 16 15700744 splice site probably benign
IGL03168:Prkdc APN 16 15834166 missense probably benign 0.02
IGL03204:Prkdc APN 16 15769801 missense probably benign 0.01
IGL03390:Prkdc APN 16 15670626 nonsense probably null
anhimid UTSW 16 15725461 critical splice donor site probably null
Bushtit UTSW 16 15752764 missense probably damaging 0.97
clover UTSW 16 15702157 splice site probably benign
crackle UTSW 16 15786050 critical splice donor site probably null
Daffy UTSW 16 15829697 missense possibly damaging 0.86
darter UTSW 16 15773613 missense possibly damaging 0.93
Elmer_fudd UTSW 16 15808058 missense probably benign 0.01
hobgoblin UTSW 16 15815986 missense probably damaging 1.00
Incubus UTSW 16 15672327 missense probably damaging 1.00
liming UTSW 16 15752829 nonsense probably null
Schreier UTSW 16 15670528 missense probably benign 0.00
screamer UTSW 16 15831282 nonsense probably null
screamer10 UTSW 16 15768025 missense probably damaging 0.98
screamer2 UTSW 16 15652552 critical splice donor site probably null
screamer3 UTSW 16 15740332 critical splice donor site probably null
screamer4 UTSW 16 15783079 missense probably benign 0.00
screamer5 UTSW 16 15687404 missense probably benign
screamer6 UTSW 16 15759605 missense probably damaging 1.00
screamer7 UTSW 16 15654817 splice site probably null
Screamer8 UTSW 16 15719433 missense probably benign 0.00
Screamer9 UTSW 16 15734922 missense probably benign 0.01
Tweetie UTSW 16 15717801 missense probably damaging 1.00
updock UTSW 16 15795094 missense probably benign
ANU23:Prkdc UTSW 16 15667731 missense possibly damaging 0.67
R0008:Prkdc UTSW 16 15708701 splice site probably benign
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0069:Prkdc UTSW 16 15726504 missense probably benign 0.03
R0125:Prkdc UTSW 16 15699007 missense probably damaging 0.98
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0132:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0137:Prkdc UTSW 16 15740332 critical splice donor site probably null
R0334:Prkdc UTSW 16 15736799 missense probably benign 0.00
R0373:Prkdc UTSW 16 15791927 missense probably damaging 1.00
R0485:Prkdc UTSW 16 15833740 missense probably damaging 0.97
R0511:Prkdc UTSW 16 15831282 nonsense probably null
R0538:Prkdc UTSW 16 15833788 missense probably damaging 1.00
R0595:Prkdc UTSW 16 15808088 missense probably damaging 1.00
R0607:Prkdc UTSW 16 15772057 missense probably damaging 0.98
R0616:Prkdc UTSW 16 15690407 missense probably damaging 1.00
R0630:Prkdc UTSW 16 15810801 missense probably damaging 1.00
R0694:Prkdc UTSW 16 15768637 missense probably damaging 1.00
R0702:Prkdc UTSW 16 15785971 missense possibly damaging 0.95
R0965:Prkdc UTSW 16 15829716 missense probably benign
R1027:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R1029:Prkdc UTSW 16 15654749 splice site probably benign
R1033:Prkdc UTSW 16 15767951 missense probably damaging 1.00
R1067:Prkdc UTSW 16 15752782 missense probably damaging 0.99
R1116:Prkdc UTSW 16 15783079 missense probably benign 0.00
R1187:Prkdc UTSW 16 15759746 missense probably damaging 0.98
R1226:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R1279:Prkdc UTSW 16 15690282 missense probably damaging 1.00
R1304:Prkdc UTSW 16 15759723 missense probably damaging 0.99
R1314:Prkdc UTSW 16 15664227 missense possibly damaging 0.68
R1351:Prkdc UTSW 16 15667700 missense possibly damaging 0.62
R1509:Prkdc UTSW 16 15731566 missense probably damaging 1.00
R1512:Prkdc UTSW 16 15687404 missense probably benign
R1531:Prkdc UTSW 16 15772106 missense probably benign 0.01
R1579:Prkdc UTSW 16 15675328 missense probably benign 0.00
R1669:Prkdc UTSW 16 15734058 missense probably damaging 1.00
R1682:Prkdc UTSW 16 15676989 missense probably benign 0.19
R1713:Prkdc UTSW 16 15795094 missense probably benign
R1762:Prkdc UTSW 16 15637961 missense probably benign
R1789:Prkdc UTSW 16 15739524 missense probably damaging 1.00
R1822:Prkdc UTSW 16 15759605 missense probably damaging 1.00
R1848:Prkdc UTSW 16 15808058 missense probably benign 0.01
R1887:Prkdc UTSW 16 15829635 missense probably benign 0.00
R1891:Prkdc UTSW 16 15725436 missense probably benign 0.02
R1921:Prkdc UTSW 16 15714215 missense possibly damaging 0.80
R1922:Prkdc UTSW 16 15714266 missense probably benign 0.00
R1929:Prkdc UTSW 16 15654817 splice site probably null
R1939:Prkdc UTSW 16 15835913 missense possibly damaging 0.95
R2021:Prkdc UTSW 16 15677009 missense probably benign 0.00
R2033:Prkdc UTSW 16 15687352 splice site probably benign
R2056:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2057:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2058:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2082:Prkdc UTSW 16 15715963 missense probably damaging 1.00
R2109:Prkdc UTSW 16 15687390 missense probably benign 0.01
R2124:Prkdc UTSW 16 15719433 missense probably benign 0.00
R2164:Prkdc UTSW 16 15705207 missense probably damaging 1.00
R2174:Prkdc UTSW 16 15734922 missense probably benign 0.01
R2191:Prkdc UTSW 16 15698824 missense probably damaging 1.00
R2270:Prkdc UTSW 16 15654817 splice site probably null
R2271:Prkdc UTSW 16 15654817 splice site probably null
R2272:Prkdc UTSW 16 15654817 splice site probably null
R2356:Prkdc UTSW 16 15684204 missense probably benign
R2852:Prkdc UTSW 16 15652552 critical splice donor site probably null
R3115:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3116:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3499:Prkdc UTSW 16 15768025 missense probably damaging 0.98
R3687:Prkdc UTSW 16 15799967 missense probably benign
R3834:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3835:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3961:Prkdc UTSW 16 15829611 splice site probably null
R4151:Prkdc UTSW 16 15816773 missense probably benign
R4233:Prkdc UTSW 16 15835919 missense probably benign 0.11
R4281:Prkdc UTSW 16 15806099 splice site probably null
R4296:Prkdc UTSW 16 15737905 missense probably damaging 0.99
R4344:Prkdc UTSW 16 15768022 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15773739 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R4497:Prkdc UTSW 16 15700653 missense probably benign 0.43
R4549:Prkdc UTSW 16 15736870 missense possibly damaging 0.89
R4594:Prkdc UTSW 16 15767966 missense possibly damaging 0.64
R4603:Prkdc UTSW 16 15810824 missense probably damaging 0.98
R4615:Prkdc UTSW 16 15663074 missense probably damaging 0.99
R4648:Prkdc UTSW 16 15816774 missense probably benign 0.05
R4662:Prkdc UTSW 16 15734052 missense probably damaging 1.00
R4680:Prkdc UTSW 16 15772030 missense probably benign 0.00
R4700:Prkdc UTSW 16 15702112 missense probably damaging 1.00
R4716:Prkdc UTSW 16 15810837 missense probably benign 0.32
R4785:Prkdc UTSW 16 15648976 missense probably benign 0.21
R4822:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R4829:Prkdc UTSW 16 15702075 missense possibly damaging 0.80
R4981:Prkdc UTSW 16 15678309 missense probably damaging 1.00
R4989:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R5059:Prkdc UTSW 16 15838018 missense probably damaging 1.00
R5074:Prkdc UTSW 16 15772048 missense probably damaging 1.00
R5115:Prkdc UTSW 16 15790580 missense probably benign
R5151:Prkdc UTSW 16 15716035 missense probably damaging 1.00
R5165:Prkdc UTSW 16 15678272 missense probably damaging 1.00
R5215:Prkdc UTSW 16 15772121 missense possibly damaging 0.64
R5270:Prkdc UTSW 16 15734955 missense probably damaging 1.00
R5278:Prkdc UTSW 16 15714974 missense probably damaging 1.00
R5351:Prkdc UTSW 16 15831312 missense probably benign 0.03
R5416:Prkdc UTSW 16 15805950 missense probably damaging 1.00
R5418:Prkdc UTSW 16 15795097 missense probably benign 0.20
R5437:Prkdc UTSW 16 15769875 missense possibly damaging 0.46
R5452:Prkdc UTSW 16 15768637 missense possibly damaging 0.96
R5518:Prkdc UTSW 16 15678308 missense probably damaging 1.00
R5538:Prkdc UTSW 16 15651469 missense probably damaging 1.00
R5589:Prkdc UTSW 16 15706791 missense probably benign 0.02
R5618:Prkdc UTSW 16 15809612 missense probably damaging 1.00
R5640:Prkdc UTSW 16 15829769 missense possibly damaging 0.86
R5661:Prkdc UTSW 16 15810770 missense possibly damaging 0.81
R5771:Prkdc UTSW 16 15664233 missense probably damaging 1.00
R5772:Prkdc UTSW 16 15779388 missense possibly damaging 0.49
R5783:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R5792:Prkdc UTSW 16 15816752 missense probably damaging 1.00
R5797:Prkdc UTSW 16 15737834 nonsense probably null
R5826:Prkdc UTSW 16 15734098 missense probably benign
R5883:Prkdc UTSW 16 15715914 missense probably benign
R5895:Prkdc UTSW 16 15752829 nonsense probably null
R5998:Prkdc UTSW 16 15783157 missense probably damaging 1.00
R6000:Prkdc UTSW 16 15829697 missense possibly damaging 0.86
R6120:Prkdc UTSW 16 15739471 missense probably benign 0.00
R6145:Prkdc UTSW 16 15772073 missense probably damaging 1.00
R6209:Prkdc UTSW 16 15790592 missense probably damaging 1.00
R6293:Prkdc UTSW 16 15787155 missense probably benign 0.00
R6321:Prkdc UTSW 16 15714919 missense probably benign
R6376:Prkdc UTSW 16 15769885 missense probably benign 0.06
R6387:Prkdc UTSW 16 15698815 missense probably benign 0.01
R6406:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R6469:Prkdc UTSW 16 15795075 missense probably benign 0.10
R6486:Prkdc UTSW 16 15752764 missense probably damaging 0.97
R6665:Prkdc UTSW 16 15786050 critical splice donor site probably null
R6703:Prkdc UTSW 16 15670528 missense probably benign 0.00
R6774:Prkdc UTSW 16 15725461 critical splice donor site probably null
R6854:Prkdc UTSW 16 15651538 missense probably damaging 1.00
R6878:Prkdc UTSW 16 15777072 missense probably benign 0.31
R6882:Prkdc UTSW 16 15783263 critical splice donor site probably null
R6882:Prkdc UTSW 16 15808156 missense probably benign 0.33
R6949:Prkdc UTSW 16 15799989 missense probably benign
R6950:Prkdc UTSW 16 15815986 missense probably damaging 1.00
R7019:Prkdc UTSW 16 15769966 missense probably benign 0.00
R7064:Prkdc UTSW 16 15790453 missense probably benign 0.00
R7097:Prkdc UTSW 16 15689343 missense probably damaging 1.00
R7201:Prkdc UTSW 16 15698803 missense probably benign 0.12
R7235:Prkdc UTSW 16 15714263 missense probably benign
R7283:Prkdc UTSW 16 15717764 missense probably benign 0.00
R7401:Prkdc UTSW 16 15648738 missense probably damaging 1.00
R7525:Prkdc UTSW 16 15672327 missense probably damaging 1.00
R7647:Prkdc UTSW 16 15737943 missense probably damaging 1.00
R7679:Prkdc UTSW 16 15831319 missense probably damaging 1.00
R7803:Prkdc UTSW 16 15806096 missense probably null 0.05
R7858:Prkdc UTSW 16 15689277 missense probably benign 0.11
R7872:Prkdc UTSW 16 15715006 missense probably benign 0.05
R7896:Prkdc UTSW 16 15708903 missense probably damaging 0.97
R8032:Prkdc UTSW 16 15779451 missense probably benign 0.00
R8055:Prkdc UTSW 16 15816885 missense probably benign 0.09
R8153:Prkdc UTSW 16 15664244 missense probably damaging 1.00
R8281:Prkdc UTSW 16 15705253 missense probably damaging 1.00
R8302:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R8322:Prkdc UTSW 16 15714141 splice site probably benign
R8401:Prkdc UTSW 16 15773613 missense possibly damaging 0.93
R8458:Prkdc UTSW 16 15790676 critical splice donor site probably null
R8515:Prkdc UTSW 16 15664368 missense probably damaging 1.00
X0023:Prkdc UTSW 16 15740278 missense probably benign
Z1176:Prkdc UTSW 16 15687422 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTCAGTTTGATTTTGGCAGC -3'
(R):5'- AGTAGGTACCACTGACTCCAAAG -3'

Sequencing Primer
(F):5'- TTGGCAGCTACAATAGTTAGATAGG -3'
(R):5'- GAATTAGGGAACCAGATTTTC -3'
Posted On2015-10-21