Mutagenetix > Incidental Mutations

Incidental Mutation 'R4720:Prdx3'

354427

Institutional Source

Beutler Lab

Gene Symbol

Prdx3

Ensembl Gene

ENSMUSG00000024997

Gene Name

peroxiredoxin 3

Synonyms

TDXM, D0Tohi1, Aop1, Prx III, Ef2l, SP22, Mer5

MMRRC Submission

041958-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.405) question?

Stock #

R4720 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60864051-60874556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60870113 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 114 (V114D)

Ref Sequence

ENSEMBL: ENSMUSP00000025961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025961]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025961
AA Change: V114D

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025961
Gene: ENSMUSG00000024997
AA Change: V114D

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
Pfam:Redoxin	59	215	8.5e-19	PFAM
Pfam:AhpC-TSA	66	199	3.6e-39	PFAM
Pfam:1-cysPrx_C	219	254	1.2e-15	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein with antioxidant function. The protein is similar to the C22 subunit of Salmonella typhimurium alkylhydroperoxide reductase, and it can rescue bacterial resistance to alkylhydroperoxide in E. coli that lack the C22 subunit. The human and mouse genes are highly conserved, and they map to the regions syntenic between mouse and human chromosomes. Sequence comparisons with recently cloned mammalian homologs suggest that these genes consist of a family that is responsible for the regulation of cellular proliferation, differentiation and antioxidant functions. This family member can protect cells from oxidative stress, and it can promote cell survival in prostate cancer. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 3, 13 and 22. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show increased fat mass, adipocyte hypertrophy, mitochondrial dysfunction, oxidative stress, adipokine dysregulation and altered lipid and glucose metabolism. Homozygotes for a gene-trap allele show reduced weight and high susceptibility to LPS-induced oxidative stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,127,422	I1124T	probably damaging	Het
Acacb	A	G	5: 114,229,914	T1658A	possibly damaging	Het
Acvrl1	C	A	15: 101,135,773	P112Q	probably damaging	Het
Als2cr12	T	C	1: 58,678,348	I135V	possibly damaging	Het
Ankar	A	T	1: 72,699,011	I4K	possibly damaging	Het
Ankfn1	G	C	11: 89,441,426	D431E	possibly damaging	Het
Apobec4	T	C	1: 152,756,674	V151A	possibly damaging	Het
Atp10b	A	G	11: 43,203,122	S498G	probably benign	Het
Azin1	A	G	15: 38,493,500	V293A	probably benign	Het
Ccdc88b	T	C	19: 6,857,715	E46G	probably damaging	Het
Ccdc96	T	C	5: 36,484,875		probably benign	Het
Ccnyl1	A	G	1: 64,713,131	D169G	probably benign	Het
Cdca3	T	A	6: 124,832,164	V89E	probably damaging	Het
Cdh19	A	T	1: 110,895,381		probably null	Het
Chka	G	A	19: 3,886,375	V238I	probably damaging	Het
Cntn3	T	C	6: 102,242,022	K546E	possibly damaging	Het
Crybg3	A	G	16: 59,539,817	V787A	probably damaging	Het
Dlgap3	T	C	4: 127,195,715		probably null	Het
Dnah8	C	T	17: 30,683,634	L889F	probably benign	Het
Dnah9	T	C	11: 66,076,358	E1658G	probably damaging	Het
Dnajc11	A	G	4: 151,968,539	D102G	probably damaging	Het
Dync1i2	T	G	2: 71,233,674	S121A	probably damaging	Het
Ece1	G	A	4: 137,957,175	E591K	probably damaging	Het
Enthd1	G	A	15: 80,560,309	S15L	probably damaging	Het
Epb41l2	T	A	10: 25,471,626	H372Q	probably damaging	Het
Errfi1	T	A	4: 150,866,747	Y211N	probably damaging	Het
Fam193b	G	A	13: 55,543,437	T208M	probably benign	Het
Fmnl2	C	T	2: 53,107,540	T501M	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm340	G	C	19: 41,585,895	A1030P	probably benign	Het
Gm4841	G	T	18: 60,270,063	D319E	probably benign	Het
Gm5724	C	A	6: 141,723,222	A495S	probably damaging	Het
Gucd1	A	G	10: 75,509,660	F187S	probably damaging	Het
Hcar2	GCGGATGCGCAC	GC	5: 123,864,689		probably null	Het
Helz2	T	C	2: 181,238,417	D502G	probably damaging	Het
Hspa2	A	G	12: 76,404,865	E111G	possibly damaging	Het
Htr2a	T	A	14: 74,645,059	S162T	probably damaging	Het
Ift80	A	G	3: 68,962,290	Y223H	possibly damaging	Het
Il1rl1	A	G	1: 40,446,678	K330E	probably benign	Het
Il23r	A	T	6: 67,423,661	F562I	probably damaging	Het
Isx	T	C	8: 74,873,859		probably null	Het
Jcad	G	A	18: 4,674,055	V606I	probably benign	Het
Kcnn2	A	T	18: 45,683,120	T333S	possibly damaging	Het
Kcnq5	C	T	1: 21,403,050	A630T	probably damaging	Het
Kif2c	T	C	4: 117,171,749	M188V	probably benign	Het
Kntc1	T	C	5: 123,765,023	V321A	possibly damaging	Het
Krtap4-8	A	T	11: 99,780,445		probably benign	Het
Lgals3bp	A	C	11: 118,398,469	L52R	probably damaging	Het
Lipk	C	A	19: 34,021,699	H126Q	probably damaging	Het
Lpgat1	T	C	1: 191,763,667	Y323H	probably damaging	Het
Lrp2	T	G	2: 69,481,173	N2654H	probably damaging	Het
Lsm14b	C	T	2: 180,027,981	Q6*	probably null	Het
Lysmd3	C	T	13: 81,669,465	A187V	possibly damaging	Het
Map2k5	A	G	9: 63,293,719	S211P	probably damaging	Het
Mlph	A	T	1: 90,941,697	I474F	probably damaging	Het
Mpped2	T	C	2: 106,783,746	S142P	probably damaging	Het
Nemf	A	C	12: 69,324,288	M678R	probably benign	Het
Nfe2l1	A	T	11: 96,827,689	Y7N	probably damaging	Het
Nfkbie	T	G	17: 45,556,306	D122E	probably benign	Het
Noc3l	C	A	19: 38,789,622	A783S	probably benign	Het
Nol8	T	C	13: 49,662,753	V761A	probably damaging	Het
Nvl	A	G	1: 181,101,587	L743P	probably damaging	Het
Olfr3	T	A	2: 36,812,472	I207F	probably benign	Het
Plcb1	A	G	2: 135,251,747	K160R	possibly damaging	Het
Plekhg3	G	T	12: 76,578,322	G1313C	possibly damaging	Het
Plekhh1	GTCAAA	G	12: 79,075,420		probably null	Het
Popdc3	G	A	10: 45,314,906	V38I	probably benign	Het
Prkdc	T	A	16: 15,667,715	S469T	probably benign	Het
Rbm22	G	A	18: 60,564,391	R56H	probably damaging	Het
Reln	A	T	5: 22,286,896	F113I	possibly damaging	Het
Rims1	A	G	1: 22,427,481	Y808H	probably damaging	Het
Rsbn1	C	A	3: 103,929,020	T458N	possibly damaging	Het
Serpina3b	A	G	12: 104,130,630	S57G	possibly damaging	Het
Skor2	G	T	18: 76,861,183		probably null	Het
Slc22a4	A	T	11: 53,988,893	Y447N	probably damaging	Het
Stx19	G	T	16: 62,822,319	R166L	probably damaging	Het
Svep1	T	C	4: 58,205,869	T170A	possibly damaging	Het
Sycp2	T	G	2: 178,374,432	S746R	probably benign	Het
Tchh	G	T	3: 93,447,882	R1543L	unknown	Het
Tjp2	T	C	19: 24,100,805	D908G	probably damaging	Het
Ttc8	C	A	12: 98,979,809	A452E	possibly damaging	Het
Unc5a	T	A	13: 55,003,883	W709R	probably null	Het
Unc80	T	A	1: 66,510,792	S736R	possibly damaging	Het
Vmn2r100	C	A	17: 19,522,526	H387Q	probably benign	Het
Vmn2r39	C	T	7: 9,023,470		probably null	Het
Vmn2r88	T	A	14: 51,413,245	D138E	probably benign	Het
Vwce	T	C	19: 10,648,467	F448L	possibly damaging	Het
Wdr75	C	T	1: 45,822,485	S695F	probably benign	Het
Zfand4	T	C	6: 116,288,161		probably null	Het
Zfp511	T	A	7: 140,037,511		probably null	Het
Zfyve9	T	C	4: 108,644,368	K584E	possibly damaging	Het

Other mutations in Prdx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02444:Prdx3	APN	19	60871461	missense	possibly damaging	0.76
IGL03114:Prdx3	APN	19	60873118	splice site	probably benign
IGL03410:Prdx3	APN	19	60871410	splice site	probably benign
R0058:Prdx3	UTSW	19	60874512	start gained	probably benign
R1612:Prdx3	UTSW	19	60874434	missense	possibly damaging	0.94
R3899:Prdx3	UTSW	19	60865183	missense	probably benign	0.44
R4654:Prdx3	UTSW	19	60865236	missense	possibly damaging	0.92
R4760:Prdx3	UTSW	19	60873183	missense	possibly damaging	0.63
R5643:Prdx3	UTSW	19	60871525	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGTGAAGTAGAAGTGACACCA -3'
(R):5'- TTTAAACATGCCTCACAATCCCATT -3'

Sequencing Primer
(F):5'- GTGACACCAAAGAATAAAATAAGACC -3'
(R):5'- GCCTCCTCAGTGCTTGGATTAAAAG -3'

Posted On

2015-10-21