Mutagenetix > Incidental Mutation

Incidental Mutation 'R4721:Zdbf2'

354430

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

041986-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R4721 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 63308792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 2110 (Q2110L)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: Q2110L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: Q2110L

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: Q2110L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: Q2110L

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.3528

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,663,150	D286G	probably benign	Het
Abca15	G	A	7: 120,350,775	E491K	probably benign	Het
Acsl5	A	G	19: 55,280,530	T208A	probably benign	Het
Adamts10	T	A	17: 33,545,537		probably null	Het
Ahcyl1	T	C	3: 107,669,917	Q313R	possibly damaging	Het
Ccdc71	C	T	9: 108,463,423	S145L	possibly damaging	Het
Cep250	A	G	2: 155,970,199	T472A	probably damaging	Het
Copa	T	C	1: 172,104,274		probably benign	Het
Crybg1	C	A	10: 43,997,887	R1075L	probably damaging	Het
Ddr2	T	A	1: 170,005,240	K84*	probably null	Het
Ddx59	C	T	1: 136,417,106	P172S	probably benign	Het
Dhx34	T	A	7: 16,197,382	Q1118L	possibly damaging	Het
Dkkl1	T	A	7: 45,207,808	I112F	probably damaging	Het
Dnah8	T	A	17: 30,725,166	C1786S	probably damaging	Het
Eml6	T	A	11: 29,838,525	D520V	possibly damaging	Het
Ergic1	T	A	17: 26,638,776	V192E	probably damaging	Het
Fat3	T	C	9: 16,029,966	E1343G	probably damaging	Het
Fxr1	T	C	3: 34,064,232	S535P	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm15446	C	T	5: 109,943,000	H373Y	probably damaging	Het
Gpr157	A	T	4: 150,098,963	N197Y	probably benign	Het
Grid2	G	A	6: 64,666,201	M982I	probably benign	Het
Hey2	G	T	10: 30,834,308	R150S	possibly damaging	Het
Hmcn1	T	C	1: 150,772,571		probably null	Het
Ighv3-3	G	A	12: 114,196,536	R85*	probably null	Het
Ighv5-4	A	T	12: 113,597,440		probably benign	Het
Igsf21	A	G	4: 140,107,310	S84P	probably benign	Het
Kif20b	A	G	19: 34,938,373	T517A	probably benign	Het
Krt83	T	C	15: 101,487,982	E244G	probably damaging	Het
Lrp1	T	C	10: 127,555,059	T2990A	possibly damaging	Het
Lrp1b	T	A	2: 40,715,369		probably null	Het
Lrrc42	A	T	4: 107,233,853	S382T	probably benign	Het
Magi2	C	T	5: 20,534,469	R737W	probably damaging	Het
Mcc	A	G	18: 44,519,556	L267P	probably damaging	Het
Mzf1	T	A	7: 13,043,296	Q727L	possibly damaging	Het
Mzf1	C	T	7: 13,043,521	R652Q	possibly damaging	Het
Nkain3	C	T	4: 20,485,015	A21T	probably damaging	Het
Nlrp4e	T	A	7: 23,321,096	V336E	possibly damaging	Het
Nptn	C	T	9: 58,640,776	R155C	probably damaging	Het
Nr2c2	T	C	6: 92,139,847	I10T	possibly damaging	Het
Olfr1148	T	A	2: 87,833,171	I44N	probably damaging	Het
Olfr341	T	C	2: 36,479,824	Y102C	probably benign	Het
Olfr385	C	T	11: 73,589,447	C97Y	probably damaging	Het
Pdzk1	G	T	3: 96,869,202	E493*	probably null	Het
Plekhh1	GTCAAA	G	12: 79,075,420		probably null	Het
Polr3b	T	C	10: 84,656,003	V342A	possibly damaging	Het
Prg3	T	C	2: 84,991,406	V125A	possibly damaging	Het
Raph1	G	A	1: 60,503,001		probably benign	Het
Rassf2	A	G	2: 132,004,438	V133A	probably benign	Het
Rbm22	G	A	18: 60,564,391	R56H	probably damaging	Het
Rbpjl	A	C	2: 164,404,527	S31R	probably benign	Het
Reln	A	G	5: 21,919,222	V2762A	probably damaging	Het
Rxrg	T	A	1: 167,625,052	I141N	probably damaging	Het
Scn7a	C	A	2: 66,684,185	G1082C	probably damaging	Het
Selenon	C	A	4: 134,543,076	E322*	probably null	Het
Sipa1	C	T	19: 5,660,385	R199Q	probably damaging	Het
Slc26a7	A	T	4: 14,510,261		probably null	Het
Slc37a4	T	C	9: 44,401,490	S314P	possibly damaging	Het
Smarce1	T	C	11: 99,220,717	I59V	probably benign	Het
Stk19	T	C	17: 34,823,144		probably null	Het
Susd2	C	T	10: 75,638,130	D544N	probably benign	Het
Tcf7l2	G	T	19: 55,931,454	R465L	possibly damaging	Het
Tfap2d	T	A	1: 19,104,760	S146T	possibly damaging	Het
Tmem156	A	G	5: 65,091,527	F10S	probably benign	Het
Tmem63c	G	T	12: 87,057,180	A68S	possibly damaging	Het
Tnfrsf21	T	C	17: 43,085,504	C560R	probably damaging	Het
Trav10n	C	T	14: 53,122,133	T7I	probably benign	Het
Ttc38	C	T	15: 85,838,746	R132W	probably benign	Het
Tvp23a	T	C	16: 10,427,411	K108R	probably benign	Het
Vmn1r233	T	C	17: 20,994,617	M24V	probably benign	Het
Vmn1r88	T	A	7: 13,178,524	L269*	probably null	Het
Vmn2r101	T	A	17: 19,612,025	M761K	probably damaging	Het
Vps13b	C	T	15: 35,910,718	Q3543*	probably null	Het
Wdr37	T	C	13: 8,854,029	E101G	possibly damaging	Het
Zc3hc1	A	G	6: 30,374,900	V214A	probably benign	Het
Zcchc9	A	T	13: 91,800,609		probably null	Het
Zfp516	T	G	18: 82,957,111	L478R	possibly damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTTAATAGGCATGACCCAAAGC -3'
(R):5'- TCGGTCGCTTTCAGCTGAATC -3'

Sequencing Primer
(F):5'- GCCCAATGCAGGAGACG -3'
(R):5'- GGTCGCTTTCAGCTGAATCCAAATAG -3'

Posted On

2015-10-21