Incidental Mutation 'R4721:Copa'
ID 354434
Institutional Source Beutler Lab
Gene Symbol Copa
Ensembl Gene ENSMUSG00000026553
Gene Name coatomer protein complex subunit alpha
Synonyms xenin
MMRRC Submission 041986-MU
Accession Numbers

Genbank: NM_009938; MGI: 1334462

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R4721 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 172082529-172122330 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 172104274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000124289] [ENSMUST00000135192]
AlphaFold Q8CIE6
Predicted Effect probably benign
Transcript: ENSMUST00000027833
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124289
SMART Domains Protein: ENSMUSP00000118899
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
Blast:WD40 1 37 2e-19 BLAST
PDB:4J8G|B 1 52 2e-23 PDB
SCOP:d1erja_ 1 52 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134468
AA Change: L725P
Predicted Effect probably benign
Transcript: ENSMUST00000135192
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150298
Predicted Effect probably benign
Transcript: ENSMUST00000152403
SMART Domains Protein: ENSMUSP00000123214
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
WD40 14 53 8.42e-7 SMART
WD40 56 94 1.38e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

 

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,150 D286G probably benign Het
Abca15 G A 7: 120,350,775 E491K probably benign Het
Acsl5 A G 19: 55,280,530 T208A probably benign Het
Adamts10 T A 17: 33,545,537 probably null Het
Ahcyl1 T C 3: 107,669,917 Q313R possibly damaging Het
Ccdc71 C T 9: 108,463,423 S145L possibly damaging Het
Cep250 A G 2: 155,970,199 T472A probably damaging Het
Crybg1 C A 10: 43,997,887 R1075L probably damaging Het
Ddr2 T A 1: 170,005,240 K84* probably null Het
Ddx59 C T 1: 136,417,106 P172S probably benign Het
Dhx34 T A 7: 16,197,382 Q1118L possibly damaging Het
Dkkl1 T A 7: 45,207,808 I112F probably damaging Het
Dnah8 T A 17: 30,725,166 C1786S probably damaging Het
Eml6 T A 11: 29,838,525 D520V possibly damaging Het
Ergic1 T A 17: 26,638,776 V192E probably damaging Het
Fat3 T C 9: 16,029,966 E1343G probably damaging Het
Fxr1 T C 3: 34,064,232 S535P possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 C T 5: 109,943,000 H373Y probably damaging Het
Gpr157 A T 4: 150,098,963 N197Y probably benign Het
Grid2 G A 6: 64,666,201 M982I probably benign Het
Hey2 G T 10: 30,834,308 R150S possibly damaging Het
Hmcn1 T C 1: 150,772,571 probably null Het
Ighv3-3 G A 12: 114,196,536 R85* probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Igsf21 A G 4: 140,107,310 S84P probably benign Het
Kif20b A G 19: 34,938,373 T517A probably benign Het
Krt83 T C 15: 101,487,982 E244G probably damaging Het
Lrp1 T C 10: 127,555,059 T2990A possibly damaging Het
Lrp1b T A 2: 40,715,369 probably null Het
Lrrc42 A T 4: 107,233,853 S382T probably benign Het
Magi2 C T 5: 20,534,469 R737W probably damaging Het
Mcc A G 18: 44,519,556 L267P probably damaging Het
Mzf1 T A 7: 13,043,296 Q727L possibly damaging Het
Mzf1 C T 7: 13,043,521 R652Q possibly damaging Het
Nkain3 C T 4: 20,485,015 A21T probably damaging Het
Nlrp4e T A 7: 23,321,096 V336E possibly damaging Het
Nptn C T 9: 58,640,776 R155C probably damaging Het
Nr2c2 T C 6: 92,139,847 I10T possibly damaging Het
Olfr1148 T A 2: 87,833,171 I44N probably damaging Het
Olfr341 T C 2: 36,479,824 Y102C probably benign Het
Olfr385 C T 11: 73,589,447 C97Y probably damaging Het
Pdzk1 G T 3: 96,869,202 E493* probably null Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Polr3b T C 10: 84,656,003 V342A possibly damaging Het
Prg3 T C 2: 84,991,406 V125A possibly damaging Het
Raph1 G A 1: 60,503,001 probably benign Het
Rassf2 A G 2: 132,004,438 V133A probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rbpjl A C 2: 164,404,527 S31R probably benign Het
Reln A G 5: 21,919,222 V2762A probably damaging Het
Rxrg T A 1: 167,625,052 I141N probably damaging Het
Scn7a C A 2: 66,684,185 G1082C probably damaging Het
Selenon C A 4: 134,543,076 E322* probably null Het
Sipa1 C T 19: 5,660,385 R199Q probably damaging Het
Slc26a7 A T 4: 14,510,261 probably null Het
Slc37a4 T C 9: 44,401,490 S314P possibly damaging Het
Smarce1 T C 11: 99,220,717 I59V probably benign Het
Stk19 T C 17: 34,823,144 probably null Het
Susd2 C T 10: 75,638,130 D544N probably benign Het
Tcf7l2 G T 19: 55,931,454 R465L possibly damaging Het
Tfap2d T A 1: 19,104,760 S146T possibly damaging Het
Tmem156 A G 5: 65,091,527 F10S probably benign Het
Tmem63c G T 12: 87,057,180 A68S possibly damaging Het
Tnfrsf21 T C 17: 43,085,504 C560R probably damaging Het
Trav10n C T 14: 53,122,133 T7I probably benign Het
Ttc38 C T 15: 85,838,746 R132W probably benign Het
Tvp23a T C 16: 10,427,411 K108R probably benign Het
Vmn1r233 T C 17: 20,994,617 M24V probably benign Het
Vmn1r88 T A 7: 13,178,524 L269* probably null Het
Vmn2r101 T A 17: 19,612,025 M761K probably damaging Het
Vps13b C T 15: 35,910,718 Q3543* probably null Het
Wdr37 T C 13: 8,854,029 E101G possibly damaging Het
Zc3hc1 A G 6: 30,374,900 V214A probably benign Het
Zcchc9 A T 13: 91,800,609 probably null Het
Zdbf2 A T 1: 63,308,792 Q2110L possibly damaging Het
Zfp516 T G 18: 82,957,111 L478R possibly damaging Het
Other mutations in Copa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copa APN 1 172110688 missense possibly damaging 0.87
IGL01360:Copa APN 1 172087588 splice site probably null
IGL01434:Copa APN 1 172119561 missense probably benign 0.00
IGL01744:Copa APN 1 172113189 missense probably benign 0.01
IGL01837:Copa APN 1 172118852 missense probably benign 0.01
IGL01988:Copa APN 1 172118264 missense probably benign 0.09
IGL02059:Copa APN 1 172099753 missense probably damaging 0.96
IGL02123:Copa APN 1 172112128 missense probably damaging 1.00
IGL02731:Copa APN 1 172102218 missense possibly damaging 0.77
IGL03114:Copa APN 1 172119268 nonsense probably null
P0027:Copa UTSW 1 172111948 missense possibly damaging 0.87
PIT4434001:Copa UTSW 1 172106175 missense probably benign 0.00
R0233:Copa UTSW 1 172087667 critical splice donor site probably null
R0465:Copa UTSW 1 172118305 missense probably damaging 1.00
R0547:Copa UTSW 1 172121687 splice site probably benign
R0568:Copa UTSW 1 172112137 missense possibly damaging 0.91
R0628:Copa UTSW 1 172091025 splice site probably benign
R1328:Copa UTSW 1 172121691 splice site probably benign
R1494:Copa UTSW 1 172104127 missense probably benign 0.27
R1728:Copa UTSW 1 172111987 missense probably benign
R1758:Copa UTSW 1 172104144 missense probably damaging 1.00
R1784:Copa UTSW 1 172111987 missense probably benign
R1942:Copa UTSW 1 172111888 missense probably damaging 1.00
R2054:Copa UTSW 1 172118957 nonsense probably null
R2299:Copa UTSW 1 172121725 missense probably benign 0.10
R2518:Copa UTSW 1 172119901 missense probably benign
R2680:Copa UTSW 1 172121404 nonsense probably null
R3080:Copa UTSW 1 172113149 missense probably damaging 1.00
R3160:Copa UTSW 1 172091233 missense probably damaging 1.00
R3161:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3973:Copa UTSW 1 172121245 missense probably benign 0.00
R3975:Copa UTSW 1 172121245 missense probably benign 0.00
R4031:Copa UTSW 1 172108375 missense probably damaging 1.00
R4155:Copa UTSW 1 172101425 missense probably damaging 1.00
R4227:Copa UTSW 1 172118115 intron probably benign
R4244:Copa UTSW 1 172110718 missense probably benign 0.00
R4254:Copa UTSW 1 172102244 missense probably damaging 1.00
R4291:Copa UTSW 1 172092397 intron probably benign
R4323:Copa UTSW 1 172119264 missense probably damaging 1.00
R4402:Copa UTSW 1 172102224 missense probably damaging 1.00
R4711:Copa UTSW 1 172119988 missense probably damaging 1.00
R4773:Copa UTSW 1 172105220 missense probably damaging 1.00
R4794:Copa UTSW 1 172119321 missense probably damaging 1.00
R4887:Copa UTSW 1 172092276 missense probably benign 0.39
R4953:Copa UTSW 1 172082886 unclassified probably benign
R5139:Copa UTSW 1 172121329 missense probably damaging 0.99
R5152:Copa UTSW 1 172118061 missense probably benign 0.34
R5297:Copa UTSW 1 172113108 missense probably damaging 1.00
R5586:Copa UTSW 1 172105222 missense probably damaging 1.00
R5698:Copa UTSW 1 172118944 nonsense probably null
R6283:Copa UTSW 1 172118848 missense possibly damaging 0.79
R6921:Copa UTSW 1 172111924 missense possibly damaging 0.63
R6934:Copa UTSW 1 172110686 missense possibly damaging 0.64
R7009:Copa UTSW 1 172091000 missense probably damaging 0.96
R7194:Copa UTSW 1 172119944 missense probably damaging 0.99
R7348:Copa UTSW 1 172102223 missense possibly damaging 0.96
R7710:Copa UTSW 1 172109844 missense possibly damaging 0.50
R7745:Copa UTSW 1 172111942 missense probably damaging 1.00
R7893:Copa UTSW 1 172119565 nonsense probably null
R8168:Copa UTSW 1 172099672 missense probably damaging 1.00
R8273:Copa UTSW 1 172118979 critical splice donor site probably null
R8704:Copa UTSW 1 172104126 missense probably benign 0.01
R8754:Copa UTSW 1 172108359 missense probably damaging 1.00
R8757:Copa UTSW 1 172119514 missense probably benign 0.04
R8759:Copa UTSW 1 172119514 missense probably benign 0.04
R8885:Copa UTSW 1 172097745 missense probably damaging 1.00
R8891:Copa UTSW 1 172119251 missense probably damaging 1.00
R8927:Copa UTSW 1 172104170 missense probably null 0.03
R8928:Copa UTSW 1 172104170 missense probably null 0.03
R8956:Copa UTSW 1 172109913 missense possibly damaging 0.65
R9063:Copa UTSW 1 172116962 missense probably benign 0.00
R9295:Copa UTSW 1 172112256 missense probably damaging 0.99
R9364:Copa UTSW 1 172117264 missense probably benign 0.00
R9437:Copa UTSW 1 172104145 missense possibly damaging 0.93
T0722:Copa UTSW 1 172111948 missense possibly damaging 0.87
Z1177:Copa UTSW 1 172106123 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTCTAGGCCATGATGGTGG -3'
(R):5'- ACTTTGCAGGCATCTGTAGTAGG -3'

Sequencing Primer
(F):5'- GGATGATTGTATTTAAGCTGGAACG -3'
(R):5'- CTGTAGTAGGATATCTTCACCACAGG -3'
Posted On 2015-10-21