Incidental Mutation 'R4721:Scn7a'
ID354436
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission 041986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4721 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66684185 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 1082 (G1082C)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: G1082C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: G1082C

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Meta Mutation Damage Score 0.8863 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,150 D286G probably benign Het
Abca15 G A 7: 120,350,775 E491K probably benign Het
Acsl5 A G 19: 55,280,530 T208A probably benign Het
Adamts10 T A 17: 33,545,537 probably null Het
Ahcyl1 T C 3: 107,669,917 Q313R possibly damaging Het
Ccdc71 C T 9: 108,463,423 S145L possibly damaging Het
Cep250 A G 2: 155,970,199 T472A probably damaging Het
Copa T C 1: 172,104,274 probably benign Het
Crybg1 C A 10: 43,997,887 R1075L probably damaging Het
Ddr2 T A 1: 170,005,240 K84* probably null Het
Ddx59 C T 1: 136,417,106 P172S probably benign Het
Dhx34 T A 7: 16,197,382 Q1118L possibly damaging Het
Dkkl1 T A 7: 45,207,808 I112F probably damaging Het
Dnah8 T A 17: 30,725,166 C1786S probably damaging Het
Eml6 T A 11: 29,838,525 D520V possibly damaging Het
Ergic1 T A 17: 26,638,776 V192E probably damaging Het
Fat3 T C 9: 16,029,966 E1343G probably damaging Het
Fxr1 T C 3: 34,064,232 S535P possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 C T 5: 109,943,000 H373Y probably damaging Het
Gpr157 A T 4: 150,098,963 N197Y probably benign Het
Grid2 G A 6: 64,666,201 M982I probably benign Het
Hey2 G T 10: 30,834,308 R150S possibly damaging Het
Hmcn1 T C 1: 150,772,571 probably null Het
Ighv3-3 G A 12: 114,196,536 R85* probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Igsf21 A G 4: 140,107,310 S84P probably benign Het
Kif20b A G 19: 34,938,373 T517A probably benign Het
Krt83 T C 15: 101,487,982 E244G probably damaging Het
Lrp1 T C 10: 127,555,059 T2990A possibly damaging Het
Lrp1b T A 2: 40,715,369 probably null Het
Lrrc42 A T 4: 107,233,853 S382T probably benign Het
Magi2 C T 5: 20,534,469 R737W probably damaging Het
Mcc A G 18: 44,519,556 L267P probably damaging Het
Mzf1 T A 7: 13,043,296 Q727L possibly damaging Het
Mzf1 C T 7: 13,043,521 R652Q possibly damaging Het
Nkain3 C T 4: 20,485,015 A21T probably damaging Het
Nlrp4e T A 7: 23,321,096 V336E possibly damaging Het
Nptn C T 9: 58,640,776 R155C probably damaging Het
Nr2c2 T C 6: 92,139,847 I10T possibly damaging Het
Olfr1148 T A 2: 87,833,171 I44N probably damaging Het
Olfr341 T C 2: 36,479,824 Y102C probably benign Het
Olfr385 C T 11: 73,589,447 C97Y probably damaging Het
Pdzk1 G T 3: 96,869,202 E493* probably null Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Polr3b T C 10: 84,656,003 V342A possibly damaging Het
Prg3 T C 2: 84,991,406 V125A possibly damaging Het
Raph1 G A 1: 60,503,001 probably benign Het
Rassf2 A G 2: 132,004,438 V133A probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rbpjl A C 2: 164,404,527 S31R probably benign Het
Reln A G 5: 21,919,222 V2762A probably damaging Het
Rxrg T A 1: 167,625,052 I141N probably damaging Het
Selenon C A 4: 134,543,076 E322* probably null Het
Sipa1 C T 19: 5,660,385 R199Q probably damaging Het
Slc26a7 A T 4: 14,510,261 probably null Het
Slc37a4 T C 9: 44,401,490 S314P possibly damaging Het
Smarce1 T C 11: 99,220,717 I59V probably benign Het
Stk19 T C 17: 34,823,144 probably null Het
Susd2 C T 10: 75,638,130 D544N probably benign Het
Tcf7l2 G T 19: 55,931,454 R465L possibly damaging Het
Tfap2d T A 1: 19,104,760 S146T possibly damaging Het
Tmem156 A G 5: 65,091,527 F10S probably benign Het
Tmem63c G T 12: 87,057,180 A68S possibly damaging Het
Tnfrsf21 T C 17: 43,085,504 C560R probably damaging Het
Trav10n C T 14: 53,122,133 T7I probably benign Het
Ttc38 C T 15: 85,838,746 R132W probably benign Het
Tvp23a T C 16: 10,427,411 K108R probably benign Het
Vmn1r233 T C 17: 20,994,617 M24V probably benign Het
Vmn1r88 T A 7: 13,178,524 L269* probably null Het
Vmn2r101 T A 17: 19,612,025 M761K probably damaging Het
Vps13b C T 15: 35,910,718 Q3543* probably null Het
Wdr37 T C 13: 8,854,029 E101G possibly damaging Het
Zc3hc1 A G 6: 30,374,900 V214A probably benign Het
Zcchc9 A T 13: 91,800,609 probably null Het
Zdbf2 A T 1: 63,308,792 Q2110L possibly damaging Het
Zfp516 T G 18: 82,957,111 L478R possibly damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R7916:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R8061:Scn7a UTSW 2 66692594 missense probably damaging 1.00
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66752269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCACTTGGAGTAAAGAAAG -3'
(R):5'- AGTGACTGTTGAGTTAGTTCCAC -3'

Sequencing Primer
(F):5'- TGGAGTAAAGAAAGAAAACCATTTCC -3'
(R):5'- ACTGTTGAGTTAGTTCCACTTACTTG -3'
Posted On2015-10-21