Mutagenetix > Incidental Mutation

Incidental Mutation 'R4721:Reln'

354452

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

041986-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R4721 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21919222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2762 (V2762A)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: V2762A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V2762A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084713

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159768

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: V2762A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V2762A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Meta Mutation Damage Score

0.1853

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,663,150	D286G	probably benign	Het
Abca15	G	A	7: 120,350,775	E491K	probably benign	Het
Acsl5	A	G	19: 55,280,530	T208A	probably benign	Het
Adamts10	T	A	17: 33,545,537		probably null	Het
Ahcyl1	T	C	3: 107,669,917	Q313R	possibly damaging	Het
Ccdc71	C	T	9: 108,463,423	S145L	possibly damaging	Het
Cep250	A	G	2: 155,970,199	T472A	probably damaging	Het
Copa	T	C	1: 172,104,274		probably benign	Het
Crybg1	C	A	10: 43,997,887	R1075L	probably damaging	Het
Ddr2	T	A	1: 170,005,240	K84*	probably null	Het
Ddx59	C	T	1: 136,417,106	P172S	probably benign	Het
Dhx34	T	A	7: 16,197,382	Q1118L	possibly damaging	Het
Dkkl1	T	A	7: 45,207,808	I112F	probably damaging	Het
Dnah8	T	A	17: 30,725,166	C1786S	probably damaging	Het
Eml6	T	A	11: 29,838,525	D520V	possibly damaging	Het
Ergic1	T	A	17: 26,638,776	V192E	probably damaging	Het
Fat3	T	C	9: 16,029,966	E1343G	probably damaging	Het
Fxr1	T	C	3: 34,064,232	S535P	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm15446	C	T	5: 109,943,000	H373Y	probably damaging	Het
Gpr157	A	T	4: 150,098,963	N197Y	probably benign	Het
Grid2	G	A	6: 64,666,201	M982I	probably benign	Het
Hey2	G	T	10: 30,834,308	R150S	possibly damaging	Het
Hmcn1	T	C	1: 150,772,571		probably null	Het
Ighv3-3	G	A	12: 114,196,536	R85*	probably null	Het
Ighv5-4	A	T	12: 113,597,440		probably benign	Het
Igsf21	A	G	4: 140,107,310	S84P	probably benign	Het
Kif20b	A	G	19: 34,938,373	T517A	probably benign	Het
Krt83	T	C	15: 101,487,982	E244G	probably damaging	Het
Lrp1	T	C	10: 127,555,059	T2990A	possibly damaging	Het
Lrp1b	T	A	2: 40,715,369		probably null	Het
Lrrc42	A	T	4: 107,233,853	S382T	probably benign	Het
Magi2	C	T	5: 20,534,469	R737W	probably damaging	Het
Mcc	A	G	18: 44,519,556	L267P	probably damaging	Het
Mzf1	T	A	7: 13,043,296	Q727L	possibly damaging	Het
Mzf1	C	T	7: 13,043,521	R652Q	possibly damaging	Het
Nkain3	C	T	4: 20,485,015	A21T	probably damaging	Het
Nlrp4e	T	A	7: 23,321,096	V336E	possibly damaging	Het
Nptn	C	T	9: 58,640,776	R155C	probably damaging	Het
Nr2c2	T	C	6: 92,139,847	I10T	possibly damaging	Het
Olfr1148	T	A	2: 87,833,171	I44N	probably damaging	Het
Olfr341	T	C	2: 36,479,824	Y102C	probably benign	Het
Olfr385	C	T	11: 73,589,447	C97Y	probably damaging	Het
Pdzk1	G	T	3: 96,869,202	E493*	probably null	Het
Plekhh1	GTCAAA	G	12: 79,075,420		probably null	Het
Polr3b	T	C	10: 84,656,003	V342A	possibly damaging	Het
Prg3	T	C	2: 84,991,406	V125A	possibly damaging	Het
Raph1	G	A	1: 60,503,001		probably benign	Het
Rassf2	A	G	2: 132,004,438	V133A	probably benign	Het
Rbm22	G	A	18: 60,564,391	R56H	probably damaging	Het
Rbpjl	A	C	2: 164,404,527	S31R	probably benign	Het
Rxrg	T	A	1: 167,625,052	I141N	probably damaging	Het
Scn7a	C	A	2: 66,684,185	G1082C	probably damaging	Het
Selenon	C	A	4: 134,543,076	E322*	probably null	Het
Sipa1	C	T	19: 5,660,385	R199Q	probably damaging	Het
Slc26a7	A	T	4: 14,510,261		probably null	Het
Slc37a4	T	C	9: 44,401,490	S314P	possibly damaging	Het
Smarce1	T	C	11: 99,220,717	I59V	probably benign	Het
Stk19	T	C	17: 34,823,144		probably null	Het
Susd2	C	T	10: 75,638,130	D544N	probably benign	Het
Tcf7l2	G	T	19: 55,931,454	R465L	possibly damaging	Het
Tfap2d	T	A	1: 19,104,760	S146T	possibly damaging	Het
Tmem156	A	G	5: 65,091,527	F10S	probably benign	Het
Tmem63c	G	T	12: 87,057,180	A68S	possibly damaging	Het
Tnfrsf21	T	C	17: 43,085,504	C560R	probably damaging	Het
Trav10n	C	T	14: 53,122,133	T7I	probably benign	Het
Ttc38	C	T	15: 85,838,746	R132W	probably benign	Het
Tvp23a	T	C	16: 10,427,411	K108R	probably benign	Het
Vmn1r233	T	C	17: 20,994,617	M24V	probably benign	Het
Vmn1r88	T	A	7: 13,178,524	L269*	probably null	Het
Vmn2r101	T	A	17: 19,612,025	M761K	probably damaging	Het
Vps13b	C	T	15: 35,910,718	Q3543*	probably null	Het
Wdr37	T	C	13: 8,854,029	E101G	possibly damaging	Het
Zc3hc1	A	G	6: 30,374,900	V214A	probably benign	Het
Zcchc9	A	T	13: 91,800,609		probably null	Het
Zdbf2	A	T	1: 63,308,792	Q2110L	possibly damaging	Het
Zfp516	T	G	18: 82,957,111	L478R	possibly damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22010127	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22045009	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22154950	missense	probably benign	0.01
IGL00755:Reln	APN	5	22060380	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22018850	critical splice donor site	probably null
IGL00900:Reln	APN	5	21980117	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21979666	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21986967	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21969033	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21919069	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22171251	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21969079	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21919175	nonsense	probably null
IGL01361:Reln	APN	5	21919021	missense	probably benign	0.06
IGL01446:Reln	APN	5	21969317	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22040405	missense	probably benign	0.40
IGL01612:Reln	APN	5	21896930	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21920438	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21947514	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22344246	nonsense	probably null
IGL01875:Reln	APN	5	21904717	missense	probably benign
IGL02013:Reln	APN	5	21950879	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21979016	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21909958	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21904731	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21910992	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21929134	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22080791	nonsense	probably null
IGL02408:Reln	APN	5	21901619	missense	probably benign	0.44
IGL02415:Reln	APN	5	21971951	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22040427	missense	probably benign	0.00
IGL02540:Reln	APN	5	22034752	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22103357	missense	probably benign	0.09
IGL02720:Reln	APN	5	21997941	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21885548	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21995365	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21910844	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21910836	missense	probably damaging	0.99
Fishing	UTSW	5	21896841	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22106060	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21925371	missense	probably benign	0.01
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22004136	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22128649	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21948449	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0266:Reln	UTSW	5	21988776	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22227513	splice site	probably benign
R0333:Reln	UTSW	5	21929242	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21950822	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22048800	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21920496	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21947408	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22051276	splice site	probably benign
R0541:Reln	UTSW	5	21980109	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22010150	missense	probably benign	0.36
R0617:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22018869	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21913230	missense	probably benign	0.44
R0704:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22227628	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22034664	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22034775	missense	probably benign
R1163:Reln	UTSW	5	21899029	missense	probably benign	0.03
R1222:Reln	UTSW	5	21986955	missense	probably null	0.97
R1226:Reln	UTSW	5	21910866	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22128602	splice site	probably benign
R1532:Reln	UTSW	5	22034744	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21960378	missense	probably benign	0.01
R1565:Reln	UTSW	5	21925213	missense	probably benign	0.05
R1618:Reln	UTSW	5	22060368	missense	probably benign	0.01
R1636:Reln	UTSW	5	21998683	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21929086	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21955095	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22010289	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21979002	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22044962	critical splice donor site	probably null
R1991:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21942627	missense	probably benign	0.01
R2072:Reln	UTSW	5	21919177	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22019000	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21969085	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22048005	missense	probably benign	0.30
R2219:Reln	UTSW	5	21972047	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21987078	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21896786	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22154956	missense	probably benign	0.00
R2321:Reln	UTSW	5	21915020	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21979690	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22344369	missense	unknown
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22040420	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21995589	splice site	probably benign
R3713:Reln	UTSW	5	21904734	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21948566	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21911014	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21910849	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21979001	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21995366	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22227630	missense	probably benign	0.45
R4044:Reln	UTSW	5	22128632	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22034584	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21901743	missense	probably benign	0.44
R4615:Reln	UTSW	5	21972872	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22152463	missense	probably benign	0.17
R4720:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R4771:Reln	UTSW	5	22049700	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22344185	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22018846	splice site	probably null
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4896:Reln	UTSW	5	21955238	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21979720	missense	probably benign	0.02
R4912:Reln	UTSW	5	21925193	missense	probably benign	0.29
R4922:Reln	UTSW	5	21995587	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21960426	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5020:Reln	UTSW	5	22034638	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21948512	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21896077	missense	probably benign	0.00
R5119:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5125:Reln	UTSW	5	21913241	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21948629	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21988765	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22103397	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22011163	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22039529	missense	probably benign
R5400:Reln	UTSW	5	21979714	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22004203	missense	probably benign	0.00
R5514:Reln	UTSW	5	21971885	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21932715	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22039665	nonsense	probably null
R5648:Reln	UTSW	5	21998572	missense	probably benign	0.04
R5649:Reln	UTSW	5	21901625	missense	probably benign	0.33
R5744:Reln	UTSW	5	22106083	missense	probably null	0.39
R5782:Reln	UTSW	5	22018056	missense	probably benign	0.01
R5815:Reln	UTSW	5	21947433	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21899113	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21911050	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21948596	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22060333	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22286944	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22152484	nonsense	probably null
R6351:Reln	UTSW	5	21901663	nonsense	probably null
R6369:Reln	UTSW	5	22051361	missense	probably benign	0.03
R6371:Reln	UTSW	5	21995513	missense	probably benign
R6374:Reln	UTSW	5	22080714	missense	probably benign	0.06
R6425:Reln	UTSW	5	21911020	nonsense	probably null
R6442:Reln	UTSW	5	21932776	missense	probably benign
R6445:Reln	UTSW	5	21919214	missense	probably benign	0.05
R6554:Reln	UTSW	5	21896840	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21929134	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21978907	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22034570	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21899179	missense	probably benign	0.18
R6932:Reln	UTSW	5	21985857	missense	probably benign	0.00
R6948:Reln	UTSW	5	21972035	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21976564	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21915087	nonsense	probably null
R7091:Reln	UTSW	5	21899029	missense	probably null	0.08
R7135:Reln	UTSW	5	21976596	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22106097	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21942620	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22047947	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21978923	missense	probably benign	0.03
R7393:Reln	UTSW	5	21976351	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22051367	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21971934	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21971953	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22103435	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21942741	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21929127	missense	probably benign	0.25
R7501:Reln	UTSW	5	22227638	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21976278	nonsense	probably null
R7588:Reln	UTSW	5	21885568	missense	probably benign	0.03
R7631:Reln	UTSW	5	21971935	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21978931	missense	probably benign	0.39
R7834:Reln	UTSW	5	22039635	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22134692	missense	probably benign	0.00
R7938:Reln	UTSW	5	21950872	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21899084	nonsense	probably null
R8062:Reln	UTSW	5	21971992	missense	probably benign	0.00
R8222:Reln	UTSW	5	21931477	nonsense	probably null
R8266:Reln	UTSW	5	22018087	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22004112	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21899029	missense	probably benign	0.03
R8523:Reln	UTSW	5	22004231	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21942674	missense	probably benign	0.37
R8801:Reln	UTSW	5	21950856	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21925259	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21885514	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21899157	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21979579	missense	probably benign	0.00
R9022:Reln	UTSW	5	21976615	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22048038	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22011061	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21925200	missense	probably benign	0.01
R9126:Reln	UTSW	5	21955196	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21950817	critical splice donor site	probably null
R9182:Reln	UTSW	5	21901619	missense	probably benign	0.44
R9196:Reln	UTSW	5	22152473	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22344202	nonsense	probably null
R9241:Reln	UTSW	5	21969069	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21915153	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21948547	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22004211	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21988707	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22080691	missense	probably benign	0.01
R9309:Reln	UTSW	5	21971868	missense	probably benign	0.37
R9338:Reln	UTSW	5	21997939	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22344204	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21915107	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22344200	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21920510	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	21931429	missense	probably benign	0.26
R9745:Reln	UTSW	5	21947527	missense	probably damaging	1.00
R9778:Reln	UTSW	5	21950945	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	21979024	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	21969241	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22004082	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22154959	missense	probably benign	0.05
Z1177:Reln	UTSW	5	22227636	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGCGAGTTAGCGTTCTAC -3'
(R):5'- ACCATGCCAATGTCCTGTGTTC -3'

Sequencing Primer
(F):5'- CCCCGTTAAGCTTTCAGGAAG -3'
(R):5'- TGTCCTGTGTTCACCAGCAAAAC -3'

Posted On

2015-10-21