Mutagenetix > Incidental Mutation

Incidental Mutation 'R4721:Smarce1'

354480

Institutional Source

Beutler Lab

Gene Symbol

Smarce1

Ensembl Gene

ENSMUSG00000037935

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1

Synonyms

2810417B20Rik, BAF57, 9030408N19Rik, 5830412H02Rik

MMRRC Submission

041986-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4721 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

99209047-99231017 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99220717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 59 (I59V)

Ref Sequence

ENSEMBL: ENSMUSP00000099422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103133]

AlphaFold

O54941

Predicted Effect

probably benign
Transcript: ENSMUST00000103133
AA Change: I59V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000099422
Gene: ENSMUSG00000037935
AA Change: I59V

Domain	Start	End	E-Value	Type
low complexity region	5	23	N/A	INTRINSIC
HMG	65	135	8.37e-15	SMART
low complexity region	149	163	N/A	INTRINSIC
Blast:HMG	165	205	1e-20	BLAST
coiled coil region	222	319	N/A	INTRINSIC
low complexity region	395	411	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128707

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135040

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155062

Meta Mutation Damage Score

0.0701

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the large ATP-dependent chromatin remodeling complex SWI/SNF, which is required for transcriptional activation of genes normally repressed by chromatin. The encoded protein, either alone or when in the SWI/SNF complex, can bind to 4-way junction DNA, which is thought to mimic the topology of DNA as it enters or exits the nucleosome. The protein contains a DNA-binding HMG domain, but disruption of this domain does not abolish the DNA-binding or nucleosome-displacement activities of the SWI/SNF complex. Unlike most of the SWI/SNF complex proteins, this protein has no yeast counterpart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,663,150	D286G	probably benign	Het
Abca15	G	A	7: 120,350,775	E491K	probably benign	Het
Acsl5	A	G	19: 55,280,530	T208A	probably benign	Het
Adamts10	T	A	17: 33,545,537		probably null	Het
Ahcyl1	T	C	3: 107,669,917	Q313R	possibly damaging	Het
Ccdc71	C	T	9: 108,463,423	S145L	possibly damaging	Het
Cep250	A	G	2: 155,970,199	T472A	probably damaging	Het
Copa	T	C	1: 172,104,274		probably benign	Het
Crybg1	C	A	10: 43,997,887	R1075L	probably damaging	Het
Ddr2	T	A	1: 170,005,240	K84*	probably null	Het
Ddx59	C	T	1: 136,417,106	P172S	probably benign	Het
Dhx34	T	A	7: 16,197,382	Q1118L	possibly damaging	Het
Dkkl1	T	A	7: 45,207,808	I112F	probably damaging	Het
Dnah8	T	A	17: 30,725,166	C1786S	probably damaging	Het
Eml6	T	A	11: 29,838,525	D520V	possibly damaging	Het
Ergic1	T	A	17: 26,638,776	V192E	probably damaging	Het
Fat3	T	C	9: 16,029,966	E1343G	probably damaging	Het
Fxr1	T	C	3: 34,064,232	S535P	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm15446	C	T	5: 109,943,000	H373Y	probably damaging	Het
Gpr157	A	T	4: 150,098,963	N197Y	probably benign	Het
Grid2	G	A	6: 64,666,201	M982I	probably benign	Het
Hey2	G	T	10: 30,834,308	R150S	possibly damaging	Het
Hmcn1	T	C	1: 150,772,571		probably null	Het
Ighv3-3	G	A	12: 114,196,536	R85*	probably null	Het
Ighv5-4	A	T	12: 113,597,440		probably benign	Het
Igsf21	A	G	4: 140,107,310	S84P	probably benign	Het
Kif20b	A	G	19: 34,938,373	T517A	probably benign	Het
Krt83	T	C	15: 101,487,982	E244G	probably damaging	Het
Lrp1	T	C	10: 127,555,059	T2990A	possibly damaging	Het
Lrp1b	T	A	2: 40,715,369		probably null	Het
Lrrc42	A	T	4: 107,233,853	S382T	probably benign	Het
Magi2	C	T	5: 20,534,469	R737W	probably damaging	Het
Mcc	A	G	18: 44,519,556	L267P	probably damaging	Het
Mzf1	T	A	7: 13,043,296	Q727L	possibly damaging	Het
Mzf1	C	T	7: 13,043,521	R652Q	possibly damaging	Het
Nkain3	C	T	4: 20,485,015	A21T	probably damaging	Het
Nlrp4e	T	A	7: 23,321,096	V336E	possibly damaging	Het
Nptn	C	T	9: 58,640,776	R155C	probably damaging	Het
Nr2c2	T	C	6: 92,139,847	I10T	possibly damaging	Het
Olfr1148	T	A	2: 87,833,171	I44N	probably damaging	Het
Olfr341	T	C	2: 36,479,824	Y102C	probably benign	Het
Olfr385	C	T	11: 73,589,447	C97Y	probably damaging	Het
Pdzk1	G	T	3: 96,869,202	E493*	probably null	Het
Plekhh1	GTCAAA	G	12: 79,075,420		probably null	Het
Polr3b	T	C	10: 84,656,003	V342A	possibly damaging	Het
Prg3	T	C	2: 84,991,406	V125A	possibly damaging	Het
Raph1	G	A	1: 60,503,001		probably benign	Het
Rassf2	A	G	2: 132,004,438	V133A	probably benign	Het
Rbm22	G	A	18: 60,564,391	R56H	probably damaging	Het
Rbpjl	A	C	2: 164,404,527	S31R	probably benign	Het
Reln	A	G	5: 21,919,222	V2762A	probably damaging	Het
Rxrg	T	A	1: 167,625,052	I141N	probably damaging	Het
Scn7a	C	A	2: 66,684,185	G1082C	probably damaging	Het
Selenon	C	A	4: 134,543,076	E322*	probably null	Het
Sipa1	C	T	19: 5,660,385	R199Q	probably damaging	Het
Slc26a7	A	T	4: 14,510,261		probably null	Het
Slc37a4	T	C	9: 44,401,490	S314P	possibly damaging	Het
Stk19	T	C	17: 34,823,144		probably null	Het
Susd2	C	T	10: 75,638,130	D544N	probably benign	Het
Tcf7l2	G	T	19: 55,931,454	R465L	possibly damaging	Het
Tfap2d	T	A	1: 19,104,760	S146T	possibly damaging	Het
Tmem156	A	G	5: 65,091,527	F10S	probably benign	Het
Tmem63c	G	T	12: 87,057,180	A68S	possibly damaging	Het
Tnfrsf21	T	C	17: 43,085,504	C560R	probably damaging	Het
Trav10n	C	T	14: 53,122,133	T7I	probably benign	Het
Ttc38	C	T	15: 85,838,746	R132W	probably benign	Het
Tvp23a	T	C	16: 10,427,411	K108R	probably benign	Het
Vmn1r233	T	C	17: 20,994,617	M24V	probably benign	Het
Vmn1r88	T	A	7: 13,178,524	L269*	probably null	Het
Vmn2r101	T	A	17: 19,612,025	M761K	probably damaging	Het
Vps13b	C	T	15: 35,910,718	Q3543*	probably null	Het
Wdr37	T	C	13: 8,854,029	E101G	possibly damaging	Het
Zc3hc1	A	G	6: 30,374,900	V214A	probably benign	Het
Zcchc9	A	T	13: 91,800,609		probably null	Het
Zdbf2	A	T	1: 63,308,792	Q2110L	possibly damaging	Het
Zfp516	T	G	18: 82,957,111	L478R	possibly damaging	Het

Other mutations in Smarce1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Smarce1	APN	11	99210187	missense	possibly damaging	0.69
IGL01477:Smarce1	APN	11	99210187	missense	possibly damaging	0.69
IGL02256:Smarce1	APN	11	99219380	missense	possibly damaging	0.63
R0524:Smarce1	UTSW	11	99214062	missense	probably damaging	1.00
R4953:Smarce1	UTSW	11	99215151	missense	probably benign	0.45
R5002:Smarce1	UTSW	11	99225063	missense	probably damaging	0.99
R7605:Smarce1	UTSW	11	99228292	missense	probably benign
R8007:Smarce1	UTSW	11	99225050	missense	possibly damaging	0.95
R8670:Smarce1	UTSW	11	99210272	missense	possibly damaging	0.61
R8977:Smarce1	UTSW	11	99219685	missense	possibly damaging	0.56
R9519:Smarce1	UTSW	11	99214107	missense	probably benign	0.01
Z1176:Smarce1	UTSW	11	99210095	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCATGCTCCTGAGTTCTGG -3'
(R):5'- CAAAACAGTGGCAATTAACTGC -3'

Sequencing Primer
(F):5'- ATGCTCCTGAGTTCTGGATTTC -3'
(R):5'- GTGGCAATTAACTGCTAAGTAAAACG -3'

Posted On

2015-10-21