Incidental Mutation 'R4721:Dnah8'
ID 354498
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms Dnahc8, P1-Loop, Hst6.7b
MMRRC Submission 041986-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R4721 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 30624354-30875264 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30725166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1786 (C1786S)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000170651
AA Change: C1786S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: C1786S

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Meta Mutation Damage Score 0.5828 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,150 D286G probably benign Het
Abca15 G A 7: 120,350,775 E491K probably benign Het
Acsl5 A G 19: 55,280,530 T208A probably benign Het
Adamts10 T A 17: 33,545,537 probably null Het
Ahcyl1 T C 3: 107,669,917 Q313R possibly damaging Het
Ccdc71 C T 9: 108,463,423 S145L possibly damaging Het
Cep250 A G 2: 155,970,199 T472A probably damaging Het
Copa T C 1: 172,104,274 probably benign Het
Crybg1 C A 10: 43,997,887 R1075L probably damaging Het
Ddr2 T A 1: 170,005,240 K84* probably null Het
Ddx59 C T 1: 136,417,106 P172S probably benign Het
Dhx34 T A 7: 16,197,382 Q1118L possibly damaging Het
Dkkl1 T A 7: 45,207,808 I112F probably damaging Het
Eml6 T A 11: 29,838,525 D520V possibly damaging Het
Ergic1 T A 17: 26,638,776 V192E probably damaging Het
Fat3 T C 9: 16,029,966 E1343G probably damaging Het
Fxr1 T C 3: 34,064,232 S535P possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 C T 5: 109,943,000 H373Y probably damaging Het
Gpr157 A T 4: 150,098,963 N197Y probably benign Het
Grid2 G A 6: 64,666,201 M982I probably benign Het
Hey2 G T 10: 30,834,308 R150S possibly damaging Het
Hmcn1 T C 1: 150,772,571 probably null Het
Ighv3-3 G A 12: 114,196,536 R85* probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Igsf21 A G 4: 140,107,310 S84P probably benign Het
Kif20b A G 19: 34,938,373 T517A probably benign Het
Krt83 T C 15: 101,487,982 E244G probably damaging Het
Lrp1 T C 10: 127,555,059 T2990A possibly damaging Het
Lrp1b T A 2: 40,715,369 probably null Het
Lrrc42 A T 4: 107,233,853 S382T probably benign Het
Magi2 C T 5: 20,534,469 R737W probably damaging Het
Mcc A G 18: 44,519,556 L267P probably damaging Het
Mzf1 T A 7: 13,043,296 Q727L possibly damaging Het
Mzf1 C T 7: 13,043,521 R652Q possibly damaging Het
Nkain3 C T 4: 20,485,015 A21T probably damaging Het
Nlrp4e T A 7: 23,321,096 V336E possibly damaging Het
Nptn C T 9: 58,640,776 R155C probably damaging Het
Nr2c2 T C 6: 92,139,847 I10T possibly damaging Het
Olfr1148 T A 2: 87,833,171 I44N probably damaging Het
Olfr341 T C 2: 36,479,824 Y102C probably benign Het
Olfr385 C T 11: 73,589,447 C97Y probably damaging Het
Pdzk1 G T 3: 96,869,202 E493* probably null Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Polr3b T C 10: 84,656,003 V342A possibly damaging Het
Prg3 T C 2: 84,991,406 V125A possibly damaging Het
Raph1 G A 1: 60,503,001 probably benign Het
Rassf2 A G 2: 132,004,438 V133A probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rbpjl A C 2: 164,404,527 S31R probably benign Het
Reln A G 5: 21,919,222 V2762A probably damaging Het
Rxrg T A 1: 167,625,052 I141N probably damaging Het
Scn7a C A 2: 66,684,185 G1082C probably damaging Het
Selenon C A 4: 134,543,076 E322* probably null Het
Sipa1 C T 19: 5,660,385 R199Q probably damaging Het
Slc26a7 A T 4: 14,510,261 probably null Het
Slc37a4 T C 9: 44,401,490 S314P possibly damaging Het
Smarce1 T C 11: 99,220,717 I59V probably benign Het
Stk19 T C 17: 34,823,144 probably null Het
Susd2 C T 10: 75,638,130 D544N probably benign Het
Tcf7l2 G T 19: 55,931,454 R465L possibly damaging Het
Tfap2d T A 1: 19,104,760 S146T possibly damaging Het
Tmem156 A G 5: 65,091,527 F10S probably benign Het
Tmem63c G T 12: 87,057,180 A68S possibly damaging Het
Tnfrsf21 T C 17: 43,085,504 C560R probably damaging Het
Trav10n C T 14: 53,122,133 T7I probably benign Het
Ttc38 C T 15: 85,838,746 R132W probably benign Het
Tvp23a T C 16: 10,427,411 K108R probably benign Het
Vmn1r233 T C 17: 20,994,617 M24V probably benign Het
Vmn1r88 T A 7: 13,178,524 L269* probably null Het
Vmn2r101 T A 17: 19,612,025 M761K probably damaging Het
Vps13b C T 15: 35,910,718 Q3543* probably null Het
Wdr37 T C 13: 8,854,029 E101G possibly damaging Het
Zc3hc1 A G 6: 30,374,900 V214A probably benign Het
Zcchc9 A T 13: 91,800,609 probably null Het
Zdbf2 A T 1: 63,308,792 Q2110L possibly damaging Het
Zfp516 T G 18: 82,957,111 L478R possibly damaging Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30677176 missense probably benign 0.06
IGL00508:Dnah8 APN 17 30855930 missense probably damaging 1.00
IGL00547:Dnah8 APN 17 30815703 nonsense probably null
IGL00551:Dnah8 APN 17 30663478 nonsense probably null
IGL00732:Dnah8 APN 17 30656641 missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30767906 nonsense probably null
IGL00840:Dnah8 APN 17 30790941 missense probably damaging 1.00
IGL00845:Dnah8 APN 17 30819276 critical splice donor site probably null
IGL00953:Dnah8 APN 17 30706457 nonsense probably null
IGL00976:Dnah8 APN 17 30851710 missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30636005 missense probably benign 0.06
IGL01467:Dnah8 APN 17 30779916 missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30683714 splice site probably benign
IGL01515:Dnah8 APN 17 30648485 missense probably benign
IGL01723:Dnah8 APN 17 30708471 missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30751591 critical splice donor site probably null
IGL01921:Dnah8 APN 17 30736141 missense probably benign
IGL01958:Dnah8 APN 17 30855895 splice site probably benign
IGL01968:Dnah8 APN 17 30656598 nonsense probably null
IGL02093:Dnah8 APN 17 30717880 missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30648417 missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 30794763 missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30706513 critical splice donor site probably null
IGL02236:Dnah8 APN 17 30649773 nonsense probably null
IGL02259:Dnah8 APN 17 30759614 missense probably benign
IGL02263:Dnah8 APN 17 30729165 missense probably benign 0.00
IGL02303:Dnah8 APN 17 30713047 missense probably benign 0.03
IGL02341:Dnah8 APN 17 30747257 missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02377:Dnah8 APN 17 30794796 missense probably damaging 0.98
IGL02390:Dnah8 APN 17 30830845 missense probably benign 0.01
IGL02392:Dnah8 APN 17 30818051 splice site probably benign
IGL02414:Dnah8 APN 17 30700413 missense probably benign
IGL02455:Dnah8 APN 17 30672334 missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30668295 missense probably benign
IGL02831:Dnah8 APN 17 30712276 missense probably benign 0.23
IGL02863:Dnah8 APN 17 30769697 missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30721110 nonsense probably null
IGL02954:Dnah8 APN 17 30704835 missense probably benign 0.30
IGL02964:Dnah8 APN 17 30746761 missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30719006 missense probably benign 0.01
IGL03081:Dnah8 APN 17 30686373 splice site probably benign
IGL03086:Dnah8 APN 17 30742780 missense probably damaging 1.00
IGL03087:Dnah8 APN 17 30784144 missense probably benign
IGL03176:Dnah8 APN 17 30694037 missense probably benign
IGL03191:Dnah8 APN 17 30726830 missense probably damaging 0.99
IGL03210:Dnah8 APN 17 30815665 missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30673920 splice site probably null
IGL03255:Dnah8 APN 17 30741381 missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30672349 missense probably benign
IGL03348:Dnah8 APN 17 30746986 missense probably damaging 0.99
Alternator UTSW 17 30765635 missense probably benign
armature UTSW 17 30708390 missense probably benign 0.02
Brush UTSW 17 30746990 missense probably damaging 1.00
Dynos UTSW 17 30715509 missense possibly damaging 0.84
joule UTSW 17 30713098 critical splice donor site probably null
solenoid UTSW 17 30741178 missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30635463 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635465 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635477 small deletion probably benign
I2288:Dnah8 UTSW 17 30663454 missense probably benign
P0029:Dnah8 UTSW 17 30765720 missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30708445 missense probably benign 0.04
R0016:Dnah8 UTSW 17 30663316 missense probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30755119 missense probably damaging 1.00
R0090:Dnah8 UTSW 17 30784090 missense probably benign 0.20
R0119:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0184:Dnah8 UTSW 17 30683683 missense probably benign 0.04
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30690271 missense probably benign
R0268:Dnah8 UTSW 17 30769707 missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30736156 missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 30871351 missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30708390 missense probably benign 0.02
R0423:Dnah8 UTSW 17 30701981 missense probably benign
R0470:Dnah8 UTSW 17 30708540 splice site probably benign
R0477:Dnah8 UTSW 17 30755080 missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30700419 missense probably benign
R0499:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30718961 missense probably benign 0.01
R0601:Dnah8 UTSW 17 30708358 missense probably benign 0.06
R0646:Dnah8 UTSW 17 30684173 missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30736155 missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30704662 missense probably benign
R0843:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R0940:Dnah8 UTSW 17 30803243 missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30673920 splice site probably null
R1102:Dnah8 UTSW 17 30854764 splice site probably null
R1137:Dnah8 UTSW 17 30855936 missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30721000 missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30737295 missense probably damaging 1.00
R1377:Dnah8 UTSW 17 30840622 nonsense probably null
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1497:Dnah8 UTSW 17 30752075 missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30673888 missense probably benign
R1541:Dnah8 UTSW 17 30747247 missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30635664 missense probably benign 0.07
R1634:Dnah8 UTSW 17 30713098 critical splice donor site probably null
R1670:Dnah8 UTSW 17 30725124 missense probably damaging 1.00
R1710:Dnah8 UTSW 17 30854940 missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30769651 missense probably benign 0.28
R1761:Dnah8 UTSW 17 30779916 missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30722937 missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30708407 missense probably benign 0.00
R1808:Dnah8 UTSW 17 30684186 missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30731180 missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30635505 missense unknown
R1935:Dnah8 UTSW 17 30726896 splice site probably benign
R1940:Dnah8 UTSW 17 30731207 missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30712385 missense probably benign 0.00
R2025:Dnah8 UTSW 17 30731159 missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30758281 missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30635658 missense probably benign 0.01
R2148:Dnah8 UTSW 17 30737258 missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30653393 missense probably benign
R2180:Dnah8 UTSW 17 30840647 missense probably benign 0.00
R2262:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2328:Dnah8 UTSW 17 30794744 missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30771872 missense probably benign
R2357:Dnah8 UTSW 17 30874935 missense probably benign 0.00
R2360:Dnah8 UTSW 17 30677204 missense probably benign 0.22
R2496:Dnah8 UTSW 17 30851731 missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30741365 nonsense probably null
R2509:Dnah8 UTSW 17 30775045 missense probably benign 0.02
R3114:Dnah8 UTSW 17 30833568 missense probably benign 0.04
R3708:Dnah8 UTSW 17 30739657 missense probably damaging 0.98
R3720:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3722:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30739648 nonsense probably null
R3747:Dnah8 UTSW 17 30784174 nonsense probably null
R3748:Dnah8 UTSW 17 30784174 nonsense probably null
R3749:Dnah8 UTSW 17 30784174 nonsense probably null
R3787:Dnah8 UTSW 17 30755041 missense probably damaging 1.00
R3790:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30670647 missense probably benign 0.00
R3857:Dnah8 UTSW 17 30663422 missense probably damaging 0.96
R3898:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3899:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3938:Dnah8 UTSW 17 30854937 missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30694065 splice site probably benign
R4091:Dnah8 UTSW 17 30769839 missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30748559 missense probably benign
R4326:Dnah8 UTSW 17 30752092 missense probably benign 0.04
R4346:Dnah8 UTSW 17 30725098 missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30752146 missense probably damaging 1.00
R4457:Dnah8 UTSW 17 30813151 missense probably benign
R4475:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4565:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4566:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4568:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4573:Dnah8 UTSW 17 30700406 missense probably benign 0.00
R4580:Dnah8 UTSW 17 30662052 missense probably benign 0.00
R4585:Dnah8 UTSW 17 30751567 missense probably benign 0.01
R4611:Dnah8 UTSW 17 30684237 missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30683634 missense probably benign 0.08
R4727:Dnah8 UTSW 17 30851747 missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4732:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4733:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4798:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4814:Dnah8 UTSW 17 30767924 missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4894:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4900:Dnah8 UTSW 17 30746975 missense probably damaging 1.00
R4901:Dnah8 UTSW 17 30840714 critical splice donor site probably null
R4913:Dnah8 UTSW 17 30819139 missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4932:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4933:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4942:Dnah8 UTSW 17 30729142 missense probably benign
R4969:Dnah8 UTSW 17 30723014 missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4977:Dnah8 UTSW 17 30663301 missense probably benign 0.00
R5001:Dnah8 UTSW 17 30787185 missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5013:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5014:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5024:Dnah8 UTSW 17 30736096 missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30739757 critical splice donor site probably null
R5075:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5075:Dnah8 UTSW 17 30800531 missense probably damaging 1.00
R5112:Dnah8 UTSW 17 30731038 missense probably benign 0.02
R5121:Dnah8 UTSW 17 30810353 missense probably benign 0.14
R5138:Dnah8 UTSW 17 30765597 missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30712295 missense probably benign 0.06
R5191:Dnah8 UTSW 17 30746765 missense probably damaging 1.00
R5238:Dnah8 UTSW 17 30790917 missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30700419 missense probably benign
R5358:Dnah8 UTSW 17 30746954 missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5404:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5482:Dnah8 UTSW 17 30800547 missense probably damaging 0.96
R5489:Dnah8 UTSW 17 30790956 missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30752916 missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30706386 missense probably benign 0.00
R5640:Dnah8 UTSW 17 30803108 missense probably damaging 1.00
R5649:Dnah8 UTSW 17 30800587 missense probably benign 0.13
R5662:Dnah8 UTSW 17 30737333 missense probably damaging 1.00
R5673:Dnah8 UTSW 17 30803261 missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5699:Dnah8 UTSW 17 30810324 missense probably benign 0.22
R5737:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5738:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5739:Dnah8 UTSW 17 30719007 missense probably benign 0.00
R5766:Dnah8 UTSW 17 30690261 missense probably benign 0.01
R5790:Dnah8 UTSW 17 30875004 missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30728191 missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 30794763 missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5886:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5887:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30656685 missense probably benign 0.32
R5979:Dnah8 UTSW 17 30815664 nonsense probably null
R5986:Dnah8 UTSW 17 30851630 missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30663305 missense probably benign 0.32
R6042:Dnah8 UTSW 17 30747265 missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6181:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6237:Dnah8 UTSW 17 30747854 nonsense probably null
R6239:Dnah8 UTSW 17 30810359 missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6365:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6416:Dnah8 UTSW 17 30765635 missense probably benign
R6443:Dnah8 UTSW 17 30771885 missense probably benign 0.10
R6478:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6479:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6480:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6481:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6533:Dnah8 UTSW 17 30746990 missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6608:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6610:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6675:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6723:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6724:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6754:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6755:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6759:Dnah8 UTSW 17 30663292 splice site probably null
R6765:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6766:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6778:Dnah8 UTSW 17 30635666 missense probably benign 0.00
R6781:Dnah8 UTSW 17 30765724 frame shift probably null
R6788:Dnah8 UTSW 17 30648465 missense probably benign 0.14
R6814:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30741173 missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30710551 missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30746959 missense probably damaging 1.00
R6944:Dnah8 UTSW 17 30794659 missense probably benign 0.09
R6982:Dnah8 UTSW 17 30767925 missense probably benign 0.03
R6984:Dnah8 UTSW 17 30739738 missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30662091 missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30643275 missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30704724 missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30741178 missense probably damaging 1.00
R7112:Dnah8 UTSW 17 30871392 missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30644617 missense probably benign 0.01
R7146:Dnah8 UTSW 17 30769644 missense possibly damaging 0.90
R7309:Dnah8 UTSW 17 30875014 missense probably damaging 1.00
R7324:Dnah8 UTSW 17 30784125 missense probably benign 0.01
R7373:Dnah8 UTSW 17 30767965 critical splice donor site probably null
R7423:Dnah8 UTSW 17 30704769 missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30706389 missense probably damaging 0.98
R7450:Dnah8 UTSW 17 30787191 missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30775103 missense probably damaging 0.98
R7604:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R7635:Dnah8 UTSW 17 30785107 missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30649677 missense probably benign 0.00
R7685:Dnah8 UTSW 17 30657973 missense probably damaging 1.00
R7793:Dnah8 UTSW 17 30855944 missense probably benign 0.20
R7827:Dnah8 UTSW 17 30760867 frame shift probably null
R7866:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30663374 missense probably benign
R7891:Dnah8 UTSW 17 30712289 missense probably benign 0.09
R7977:Dnah8 UTSW 17 30744524 missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30744524 missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30741337 nonsense probably null
R8076:Dnah8 UTSW 17 30784153 missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30673823 missense probably damaging 1.00
R8199:Dnah8 UTSW 17 30871419 missense probably benign 0.06
R8253:Dnah8 UTSW 17 30760867 frame shift probably null
R8270:Dnah8 UTSW 17 30840713 missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30765727 missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30769831 missense probably benign 0.12
R8348:Dnah8 UTSW 17 30673840 missense probably benign
R8348:Dnah8 UTSW 17 30736147 missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30643260 missense probably benign 0.17
R8355:Dnah8 UTSW 17 30695178 missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30760867 frame shift probably null
R8448:Dnah8 UTSW 17 30673840 missense probably benign
R8459:Dnah8 UTSW 17 30725247 critical splice donor site probably null
R8462:Dnah8 UTSW 17 30656629 missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30721134 missense probably benign
R8524:Dnah8 UTSW 17 30715498 missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30721110 nonsense probably null
R8698:Dnah8 UTSW 17 30875035 missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30741315 missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30760867 frame shift probably null
R8781:Dnah8 UTSW 17 30725104 missense probably damaging 1.00
R8821:Dnah8 UTSW 17 30794738 missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30762642 missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30708312 missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 30851654 missense probably damaging 0.98
R8994:Dnah8 UTSW 17 30790833 missense probably benign 0.05
R9031:Dnah8 UTSW 17 30737427 missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30756755 missense possibly damaging 0.63
R9105:Dnah8 UTSW 17 30760867 frame shift probably null
R9127:Dnah8 UTSW 17 30760867 frame shift probably null
R9225:Dnah8 UTSW 17 30635673 missense probably benign 0.01
R9280:Dnah8 UTSW 17 30785097 missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30725125 missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30771883 missense probably benign
R9347:Dnah8 UTSW 17 30708359 missense probably benign 0.00
R9393:Dnah8 UTSW 17 30653387 missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 30810323 missense probably benign 0.02
RF027:Dnah8 UTSW 17 30635476 frame shift probably null
X0001:Dnah8 UTSW 17 30748680 missense probably damaging 1.00
X0013:Dnah8 UTSW 17 30819186 missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30648540 missense probably benign
Z1177:Dnah8 UTSW 17 30694033 missense probably benign
Z1177:Dnah8 UTSW 17 30713095 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGCATTTTAATAAGCAGC -3'
(R):5'- TTGCTATTCCAGTGGAACCACC -3'

Sequencing Primer
(F):5'- GGGTCTCGTTCTTCAGAATTAATTC -3'
(R):5'- CCACAGAAATAGCTGAAATGCTC -3'
Posted On 2015-10-21