Incidental Mutation 'R4722:Scn7a'
ID354514
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission 041987-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4722 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66700884 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 550 (T550S)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042792
AA Change: T550S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: T550S

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Meta Mutation Damage Score 0.5856 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G T 12: 55,061,137 D92E probably benign Het
Abca17 A G 17: 24,265,429 F1620L probably damaging Het
Abcf1 T C 17: 35,958,041 probably benign Het
Adtrp T C 13: 41,767,347 H248R probably benign Het
Aldh1b1 T G 4: 45,803,472 F337V probably damaging Het
Amz2 C T 11: 109,434,631 L272F probably damaging Het
Asic2 A T 11: 81,968,183 M1K probably null Het
Avpr1a T A 10: 122,449,001 V66E possibly damaging Het
AW554918 C A 18: 25,174,715 Y28* probably null Het
Ccdc130 A T 8: 84,258,810 C277S probably benign Het
Cdc25b C T 2: 131,193,351 P343L probably damaging Het
Chd7 T A 4: 8,822,445 I846K probably damaging Het
Dnajc13 A T 9: 104,213,818 M688K probably benign Het
Dock2 T A 11: 34,695,471 I505F probably damaging Het
Dpy19l4 A G 4: 11,290,521 V290A possibly damaging Het
Dtl G T 1: 191,556,841 Q254K possibly damaging Het
Enpp2 T G 15: 54,887,589 K265T probably damaging Het
Epm2aip1 TGTCGCCG TG 9: 111,272,084 probably benign Het
Fam133b T A 5: 3,543,949 probably null Het
Fuom A G 7: 140,099,567 probably benign Het
Fut9 T C 4: 25,799,734 probably benign Het
Gas8 T A 8: 123,525,635 I171N possibly damaging Het
Gipc3 T G 10: 81,341,295 D147A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5591 T C 7: 38,519,148 K767R probably damaging Het
Kctd8 G A 5: 69,341,201 P34L possibly damaging Het
Kmt2b G A 7: 30,583,202 R403C probably damaging Het
Krt84 A T 15: 101,528,411 I396N probably damaging Het
Lrrk2 C A 15: 91,688,901 F217L probably damaging Het
Med27 T A 2: 29,524,435 D290E probably damaging Het
Mical3 T C 6: 121,038,525 Q184R probably benign Het
Mlxip A T 5: 123,447,202 K591M probably benign Het
Mutyh T A 4: 116,816,872 L233H probably damaging Het
Naip6 G T 13: 100,307,072 H253N possibly damaging Het
Nynrin A G 14: 55,854,395 E56G probably damaging Het
Oip5 C T 2: 119,613,011 probably null Het
Olfr1199 T G 2: 88,756,012 H221P possibly damaging Het
Olfr1211 T C 2: 88,929,980 I112V possibly damaging Het
Olfr1335 T C 4: 118,808,949 N305S probably damaging Het
Olfr17 T A 7: 107,097,570 I35N possibly damaging Het
Olfr485 T A 7: 108,159,238 I212F probably benign Het
Oxr1 T C 15: 41,813,649 S132P probably damaging Het
Pcdhac1 C T 18: 37,091,880 T582I probably damaging Het
Prl7a2 A G 13: 27,660,875 I176T probably damaging Het
Rabgap1l T C 1: 160,342,164 T30A possibly damaging Het
Rapgef2 A G 3: 79,069,173 M1294T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rnmt T A 18: 68,305,881 N20K probably damaging Het
Shank1 T A 7: 44,313,214 Y117* probably null Het
Skint5 T A 4: 113,893,855 K331I unknown Het
Slc5a1 A G 5: 33,146,711 Y290C possibly damaging Het
Slfn14 T C 11: 83,283,418 E249G probably benign Het
Smarcal1 T C 1: 72,611,337 S544P probably damaging Het
St6galnac3 A T 3: 153,411,529 Y186N probably damaging Het
Tbc1d1 T C 5: 64,263,557 F346S probably damaging Het
Tdrd5 A T 1: 156,302,375 I75K probably benign Het
Tnrc6a T C 7: 123,192,090 M1737T possibly damaging Het
Toe1 A T 4: 116,805,200 Y283N probably damaging Het
Tubal3 G T 13: 3,928,185 G34C probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn1r212 T C 13: 22,883,908 Y85C probably damaging Het
Zdhhc4 A G 5: 143,321,781 S162P probably damaging Het
Zfp712 A G 13: 67,042,113 S117P probably benign Het
Zic4 G T 9: 91,379,204 G164C probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R7916:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R8061:Scn7a UTSW 2 66692594 missense probably damaging 1.00
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66752269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTTGAATTCTACTTACTGGGAC -3'
(R):5'- GATAATCTTTCCTCAAGAACAGCG -3'

Sequencing Primer
(F):5'- CTAGTCCTTCAACATCTGCT -3'
(R):5'- AACTGTGTAGCAGGTCATGGC -3'
Posted On2015-10-21