Incidental Mutation 'R4722:Tnrc6a'
ID354540
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
MMRRC Submission 041987-MU
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R4722 (G1)
Quality Score207
Status Validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123192090 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1737 (M1737T)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094053
AA Change: M1737T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: M1737T

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect unknown
Transcript: ENSMUST00000205760
AA Change: M1238T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206126
Meta Mutation Damage Score 0.3079 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G T 12: 55,061,137 D92E probably benign Het
Abca17 A G 17: 24,265,429 F1620L probably damaging Het
Abcf1 T C 17: 35,958,041 probably benign Het
Adtrp T C 13: 41,767,347 H248R probably benign Het
Aldh1b1 T G 4: 45,803,472 F337V probably damaging Het
Amz2 C T 11: 109,434,631 L272F probably damaging Het
Asic2 A T 11: 81,968,183 M1K probably null Het
Avpr1a T A 10: 122,449,001 V66E possibly damaging Het
AW554918 C A 18: 25,174,715 Y28* probably null Het
Ccdc130 A T 8: 84,258,810 C277S probably benign Het
Cdc25b C T 2: 131,193,351 P343L probably damaging Het
Chd7 T A 4: 8,822,445 I846K probably damaging Het
Dnajc13 A T 9: 104,213,818 M688K probably benign Het
Dock2 T A 11: 34,695,471 I505F probably damaging Het
Dpy19l4 A G 4: 11,290,521 V290A possibly damaging Het
Dtl G T 1: 191,556,841 Q254K possibly damaging Het
Enpp2 T G 15: 54,887,589 K265T probably damaging Het
Epm2aip1 TGTCGCCG TG 9: 111,272,084 probably benign Het
Fam133b T A 5: 3,543,949 probably null Het
Fuom A G 7: 140,099,567 probably benign Het
Fut9 T C 4: 25,799,734 probably benign Het
Gas8 T A 8: 123,525,635 I171N possibly damaging Het
Gipc3 T G 10: 81,341,295 D147A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5591 T C 7: 38,519,148 K767R probably damaging Het
Kctd8 G A 5: 69,341,201 P34L possibly damaging Het
Kmt2b G A 7: 30,583,202 R403C probably damaging Het
Krt84 A T 15: 101,528,411 I396N probably damaging Het
Lrrk2 C A 15: 91,688,901 F217L probably damaging Het
Med27 T A 2: 29,524,435 D290E probably damaging Het
Mical3 T C 6: 121,038,525 Q184R probably benign Het
Mlxip A T 5: 123,447,202 K591M probably benign Het
Mutyh T A 4: 116,816,872 L233H probably damaging Het
Naip6 G T 13: 100,307,072 H253N possibly damaging Het
Nynrin A G 14: 55,854,395 E56G probably damaging Het
Oip5 C T 2: 119,613,011 probably null Het
Olfr1199 T G 2: 88,756,012 H221P possibly damaging Het
Olfr1211 T C 2: 88,929,980 I112V possibly damaging Het
Olfr1335 T C 4: 118,808,949 N305S probably damaging Het
Olfr17 T A 7: 107,097,570 I35N possibly damaging Het
Olfr485 T A 7: 108,159,238 I212F probably benign Het
Oxr1 T C 15: 41,813,649 S132P probably damaging Het
Pcdhac1 C T 18: 37,091,880 T582I probably damaging Het
Prl7a2 A G 13: 27,660,875 I176T probably damaging Het
Rabgap1l T C 1: 160,342,164 T30A possibly damaging Het
Rapgef2 A G 3: 79,069,173 M1294T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rnmt T A 18: 68,305,881 N20K probably damaging Het
Scn7a T A 2: 66,700,884 T550S possibly damaging Het
Shank1 T A 7: 44,313,214 Y117* probably null Het
Skint5 T A 4: 113,893,855 K331I unknown Het
Slc5a1 A G 5: 33,146,711 Y290C possibly damaging Het
Slfn14 T C 11: 83,283,418 E249G probably benign Het
Smarcal1 T C 1: 72,611,337 S544P probably damaging Het
St6galnac3 A T 3: 153,411,529 Y186N probably damaging Het
Tbc1d1 T C 5: 64,263,557 F346S probably damaging Het
Tdrd5 A T 1: 156,302,375 I75K probably benign Het
Toe1 A T 4: 116,805,200 Y283N probably damaging Het
Tubal3 G T 13: 3,928,185 G34C probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn1r212 T C 13: 22,883,908 Y85C probably damaging Het
Zdhhc4 A G 5: 143,321,781 S162P probably damaging Het
Zfp712 A G 13: 67,042,113 S117P probably benign Het
Zic4 G T 9: 91,379,204 G164C probably damaging Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
R7500:Tnrc6a UTSW 7 123173450 splice site probably null
R7872:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R8270:Tnrc6a UTSW 7 123170071 missense possibly damaging 0.92
R8313:Tnrc6a UTSW 7 123170713 missense possibly damaging 0.92
R8348:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8390:Tnrc6a UTSW 7 123162571 missense probably damaging 0.97
R8448:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8514:Tnrc6a UTSW 7 123184215 nonsense probably null
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 123162496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACATGAAGCCGTGCCTG -3'
(R):5'- CTAGGCTCAAGTTATCCCTCCG -3'

Sequencing Primer
(F):5'- CCTGGGGTGATGACTCATCG -3'
(R):5'- TTAACCAGGTCTACACAGGGGTC -3'
Posted On2015-10-21