Mutagenetix > Incidental Mutation

Incidental Mutation 'R0206:Arhgef5'

35455

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

038459-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0206 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43273341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 342 (E342G)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: E342G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: E342G

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.2%
3x: 97.1%
10x: 94.6%
20x: 89.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,282,662	C5R	probably damaging	Het
4930430F08Rik	T	A	10: 100,586,194	K69*	probably null	Het
A530064D06Rik	G	A	17: 48,163,318	T165I	probably benign	Het
A830010M20Rik	A	G	5: 107,505,040	T304A	probably benign	Het
Acsl5	A	G	19: 55,280,569	K221E	probably benign	Het
Adam26a	A	C	8: 43,570,418	F12V	possibly damaging	Het
Adgrb2	T	C	4: 129,992,559	L164P	probably damaging	Het
Aldh1l1	T	C	6: 90,569,866	F384L	possibly damaging	Het
C130079G13Rik	C	T	3: 59,932,689	R61C	probably damaging	Het
Cacna1b	A	G	2: 24,607,480	S2140P	probably damaging	Het
Camsap2	G	C	1: 136,281,000	P918R	probably damaging	Het
Cdca3	C	T	6: 124,832,551		probably benign	Het
Cenpj	G	T	14: 56,563,970	A182E	probably benign	Het
Cit	A	T	5: 115,994,030	N1782Y	possibly damaging	Het
Cmya5	A	G	13: 93,095,557	S1008P	probably damaging	Het
Csgalnact2	T	G	6: 118,114,386	Q197P	probably benign	Het
D630045J12Rik	A	G	6: 38,139,450	M1745T	probably damaging	Het
Ddt	A	G	10: 75,772,885	M1T	probably null	Het
Dnah11	A	C	12: 118,043,774	N2156K	probably damaging	Het
Dock3	G	T	9: 106,996,996	Y425*	probably null	Het
Eng	A	T	2: 32,678,993	T511S	probably benign	Het
Fam192a	A	G	8: 94,588,011	F73S	probably damaging	Het
Gabra6	C	T	11: 42,317,079	W188*	probably null	Het
Gnptab	A	T	10: 88,439,510	H1111L	probably damaging	Het
H2-M10.4	A	G	17: 36,460,483	W268R	probably damaging	Het
Hrct1	C	A	4: 43,727,384	T8K	possibly damaging	Het
Il2ra	T	C	2: 11,682,017		probably benign	Het
Inpp5k	T	C	11: 75,631,143	I15T	probably benign	Het
Ipcef1	A	G	10: 6,920,062	S113P	probably damaging	Het
Kctd8	A	T	5: 69,341,165	V46E	probably damaging	Het
Klk1b9	T	A	7: 43,979,430	N119K	possibly damaging	Het
Krtap9-3	C	A	11: 99,597,837	C73F	probably damaging	Het
Loxhd1	T	A	18: 77,404,866	F1334L	possibly damaging	Het
Me3	A	T	7: 89,849,660	T483S	probably benign	Het
Med1	A	G	11: 98,155,689		probably benign	Het
Med13	A	G	11: 86,300,856		probably benign	Het
Mvk	C	T	5: 114,458,974	T334M	probably damaging	Het
Mxra8	T	A	4: 155,842,596	I329N	probably damaging	Het
Mybphl	T	C	3: 108,375,415	V207A	probably damaging	Het
Myom1	T	C	17: 71,037,297	S266P	probably damaging	Het
Nr2f2	G	C	7: 70,360,175	P52R	probably damaging	Het
Olfr1032	T	C	2: 86,008,292	I172T	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr308	T	C	7: 86,321,646	Y102C	probably benign	Het
Olfr412	A	T	11: 74,365,142	I158F	probably benign	Het
Olfr690	A	T	7: 105,329,883	M103K	possibly damaging	Het
Olfr693	A	G	7: 106,677,574	V304A	probably benign	Het
Pcdhb18	T	C	18: 37,490,187	I190T	possibly damaging	Het
Pgbd1	A	C	13: 21,434,481	L2R	probably damaging	Het
Pkp4	A	G	2: 59,266,436	I61V	probably damaging	Het
Pold4	T	G	19: 4,232,539	Y58*	probably null	Het
Pomgnt1	T	C	4: 116,158,560		probably null	Het
Prex2	T	A	1: 11,285,144	D1556E	probably damaging	Het
Psmd1	T	C	1: 86,133,741	V891A	possibly damaging	Het
Rmdn2	T	A	17: 79,650,287		probably benign	Het
Ryr2	A	G	13: 11,676,251		probably benign	Het
Scgb2b27	C	A	7: 34,012,137	E96*	probably null	Het
Sec16b	G	T	1: 157,552,935	G359*	probably null	Het
Slc1a3	A	G	15: 8,708,556		probably benign	Het
Slc28a1	A	T	7: 81,117,706		probably benign	Het
Slc35d1	T	C	4: 103,208,154	T177A	probably damaging	Het
Snx33	G	A	9: 56,926,224	S187L	probably damaging	Het
Spg11	C	T	2: 122,055,696		probably null	Het
Spint1	T	C	2: 119,248,345		probably benign	Het
Spta1	A	G	1: 174,192,960	H545R	probably damaging	Het
Tinag	A	G	9: 76,999,852	I367T	probably damaging	Het
Tln1	C	T	4: 43,549,151	V644M	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ube4b	T	C	4: 149,398,637	H58R	probably benign	Het
Ush2a	A	C	1: 188,531,761	I1612L	probably damaging	Het
Usp28	A	G	9: 49,028,269	Y275C	probably damaging	Het
Vmn2r6	T	C	3: 64,539,912	T578A	probably benign	Het
Vps13c	A	G	9: 67,939,162		probably benign	Het
Vwf	T	C	6: 125,637,456	F1100S	probably damaging	Het
Zfp318	G	T	17: 46,399,019	R556L	probably benign	Het
Zkscan1	T	A	5: 138,101,186	C391S	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTCAATCTCAGGAAGCCCAGGGAC -3'
(R):5'- AGAACCTCAGGATCTACGGAAGCC -3'

Sequencing Primer
(F):5'- CCAAAGCTATATGCTACTTGGAGG -3'
(R):5'- AAGAGAAGGCTTGCTGTCCTC -3'

Posted On

2013-05-09