Incidental Mutation 'R4722:Prl7a2'
ID354556
Institutional Source Beutler Lab
Gene Symbol Prl7a2
Ensembl Gene ENSMUSG00000046899
Gene Nameprolactin family 7, subfamily a, member 2
SynonymsPLP-F, Prlpf
MMRRC Submission 041987-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4722 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27658584-27668036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27660875 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 176 (I176T)
Ref Sequence ENSEMBL: ENSMUSP00000006660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006660]
Predicted Effect probably damaging
Transcript: ENSMUST00000006660
AA Change: I176T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006660
Gene: ENSMUSG00000046899
AA Change: I176T

DomainStartEndE-ValueType
Pfam:Hormone_1 17 244 6.9e-45 PFAM
Meta Mutation Damage Score 0.9533 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G T 12: 55,061,137 D92E probably benign Het
Abca17 A G 17: 24,265,429 F1620L probably damaging Het
Abcf1 T C 17: 35,958,041 probably benign Het
Adtrp T C 13: 41,767,347 H248R probably benign Het
Aldh1b1 T G 4: 45,803,472 F337V probably damaging Het
Amz2 C T 11: 109,434,631 L272F probably damaging Het
Asic2 A T 11: 81,968,183 M1K probably null Het
Avpr1a T A 10: 122,449,001 V66E possibly damaging Het
AW554918 C A 18: 25,174,715 Y28* probably null Het
Ccdc130 A T 8: 84,258,810 C277S probably benign Het
Cdc25b C T 2: 131,193,351 P343L probably damaging Het
Chd7 T A 4: 8,822,445 I846K probably damaging Het
Dnajc13 A T 9: 104,213,818 M688K probably benign Het
Dock2 T A 11: 34,695,471 I505F probably damaging Het
Dpy19l4 A G 4: 11,290,521 V290A possibly damaging Het
Dtl G T 1: 191,556,841 Q254K possibly damaging Het
Enpp2 T G 15: 54,887,589 K265T probably damaging Het
Epm2aip1 TGTCGCCG TG 9: 111,272,084 probably benign Het
Fam133b T A 5: 3,543,949 probably null Het
Fuom A G 7: 140,099,567 probably benign Het
Fut9 T C 4: 25,799,734 probably benign Het
Gas8 T A 8: 123,525,635 I171N possibly damaging Het
Gipc3 T G 10: 81,341,295 D147A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5591 T C 7: 38,519,148 K767R probably damaging Het
Kctd8 G A 5: 69,341,201 P34L possibly damaging Het
Kmt2b G A 7: 30,583,202 R403C probably damaging Het
Krt84 A T 15: 101,528,411 I396N probably damaging Het
Lrrk2 C A 15: 91,688,901 F217L probably damaging Het
Med27 T A 2: 29,524,435 D290E probably damaging Het
Mical3 T C 6: 121,038,525 Q184R probably benign Het
Mlxip A T 5: 123,447,202 K591M probably benign Het
Mutyh T A 4: 116,816,872 L233H probably damaging Het
Naip6 G T 13: 100,307,072 H253N possibly damaging Het
Nynrin A G 14: 55,854,395 E56G probably damaging Het
Oip5 C T 2: 119,613,011 probably null Het
Olfr1199 T G 2: 88,756,012 H221P possibly damaging Het
Olfr1211 T C 2: 88,929,980 I112V possibly damaging Het
Olfr1335 T C 4: 118,808,949 N305S probably damaging Het
Olfr17 T A 7: 107,097,570 I35N possibly damaging Het
Olfr485 T A 7: 108,159,238 I212F probably benign Het
Oxr1 T C 15: 41,813,649 S132P probably damaging Het
Pcdhac1 C T 18: 37,091,880 T582I probably damaging Het
Rabgap1l T C 1: 160,342,164 T30A possibly damaging Het
Rapgef2 A G 3: 79,069,173 M1294T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rnmt T A 18: 68,305,881 N20K probably damaging Het
Scn7a T A 2: 66,700,884 T550S possibly damaging Het
Shank1 T A 7: 44,313,214 Y117* probably null Het
Skint5 T A 4: 113,893,855 K331I unknown Het
Slc5a1 A G 5: 33,146,711 Y290C possibly damaging Het
Slfn14 T C 11: 83,283,418 E249G probably benign Het
Smarcal1 T C 1: 72,611,337 S544P probably damaging Het
St6galnac3 A T 3: 153,411,529 Y186N probably damaging Het
Tbc1d1 T C 5: 64,263,557 F346S probably damaging Het
Tdrd5 A T 1: 156,302,375 I75K probably benign Het
Tnrc6a T C 7: 123,192,090 M1737T possibly damaging Het
Toe1 A T 4: 116,805,200 Y283N probably damaging Het
Tubal3 G T 13: 3,928,185 G34C probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn1r212 T C 13: 22,883,908 Y85C probably damaging Het
Zdhhc4 A G 5: 143,321,781 S162P probably damaging Het
Zfp712 A G 13: 67,042,113 S117P probably benign Het
Zic4 G T 9: 91,379,204 G164C probably damaging Het
Other mutations in Prl7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Prl7a2 APN 13 27659208 missense probably damaging 0.98
IGL02424:Prl7a2 APN 13 27667970 missense probably null 0.08
IGL02734:Prl7a2 APN 13 27659207 missense probably benign 0.38
IGL02823:Prl7a2 APN 13 27662751 missense possibly damaging 0.95
PIT4260001:Prl7a2 UTSW 13 27659276 nonsense probably null
R0733:Prl7a2 UTSW 13 27662688 missense probably damaging 1.00
R1371:Prl7a2 UTSW 13 27662767 missense probably benign 0.01
R1778:Prl7a2 UTSW 13 27659271 missense probably damaging 0.98
R1857:Prl7a2 UTSW 13 27659180 nonsense probably null
R2063:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2064:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2065:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2067:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2068:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2176:Prl7a2 UTSW 13 27659106 missense probably benign 0.10
R2213:Prl7a2 UTSW 13 27665068 missense probably benign 0.06
R4111:Prl7a2 UTSW 13 27665067 missense possibly damaging 0.96
R4459:Prl7a2 UTSW 13 27665996 missense probably benign 0.21
R4483:Prl7a2 UTSW 13 27660947 missense possibly damaging 0.80
R5360:Prl7a2 UTSW 13 27659160 missense probably benign 0.22
R5778:Prl7a2 UTSW 13 27661000 nonsense probably null
R6667:Prl7a2 UTSW 13 27661041 missense probably benign 0.03
R7107:Prl7a2 UTSW 13 27659093 missense possibly damaging 0.89
R7600:Prl7a2 UTSW 13 27659281 missense possibly damaging 0.63
R8298:Prl7a2 UTSW 13 27661011 missense probably benign 0.00
R8447:Prl7a2 UTSW 13 27665958 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GGCCATGGTATGTAAGGAATGC -3'
(R):5'- TGGCTGCTTAGTTTAACGAATTTCC -3'

Sequencing Primer
(F):5'- TTCACTCTGCTCAAAGAAAGAGG -3'
(R):5'- CGAATTTCCAAAGCTGATCCTC -3'
Posted On2015-10-21