Incidental Mutation 'R4723:Ccdc39'
ID 354580
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Name coiled-coil domain containing 39
Synonyms b2b1735Clo, D3Ertd789e, prh, 4921507O14Rik, b2b1304Clo, b2b2025.1Clo
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.777) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 33866511-33898459 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33867227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 928 (N928S)
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000199222]
AlphaFold Q9D5Y1
Predicted Effect possibly damaging
Transcript: ENSMUST00000029222
AA Change: N928S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: N928S

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099153
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108210
SMART Domains Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
coiled coil region 415 476 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117915
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197317
Predicted Effect probably benign
Transcript: ENSMUST00000199222
SMART Domains Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200536
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33,886,717 (GRCm39) missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33,871,107 (GRCm39) unclassified probably benign
IGL02426:Ccdc39 APN 3 33,879,547 (GRCm39) missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33,879,643 (GRCm39) missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33,884,267 (GRCm39) missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33,891,992 (GRCm39) missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33,898,301 (GRCm39) missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33,898,301 (GRCm39) missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33,873,988 (GRCm39) missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33,898,274 (GRCm39) missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1331:Ccdc39 UTSW 3 33,869,634 (GRCm39) missense probably benign 0.34
R1370:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1385:Ccdc39 UTSW 3 33,875,561 (GRCm39) missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33,893,294 (GRCm39) missense possibly damaging 0.60
R1769:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1965:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33,874,045 (GRCm39) missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33,869,650 (GRCm39) missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33,875,581 (GRCm39) missense possibly damaging 0.46
R2207:Ccdc39 UTSW 3 33,890,882 (GRCm39) missense probably damaging 0.97
R2208:Ccdc39 UTSW 3 33,895,327 (GRCm39) missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33,869,633 (GRCm39) missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33,891,987 (GRCm39) missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33,868,646 (GRCm39) missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33,874,044 (GRCm39) missense probably damaging 1.00
R3804:Ccdc39 UTSW 3 33,874,044 (GRCm39) missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33,879,628 (GRCm39) missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33,892,031 (GRCm39) missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33,880,671 (GRCm39) missense probably benign 0.01
R4462:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R4653:Ccdc39 UTSW 3 33,873,955 (GRCm39) critical splice donor site probably null
R4908:Ccdc39 UTSW 3 33,893,242 (GRCm39) splice site probably null
R5236:Ccdc39 UTSW 3 33,884,251 (GRCm39) missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33,879,699 (GRCm39) missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33,871,086 (GRCm39) missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33,880,710 (GRCm39) missense possibly damaging 0.95
R6130:Ccdc39 UTSW 3 33,895,341 (GRCm39) splice site probably null
R6375:Ccdc39 UTSW 3 33,868,516 (GRCm39) missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33,892,108 (GRCm39) missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33,884,242 (GRCm39) missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33,874,017 (GRCm39) missense probably damaging 1.00
R7183:Ccdc39 UTSW 3 33,868,620 (GRCm39) missense probably damaging 1.00
R7269:Ccdc39 UTSW 3 33,884,254 (GRCm39) missense probably benign 0.00
R7348:Ccdc39 UTSW 3 33,886,825 (GRCm39) missense possibly damaging 0.55
R7645:Ccdc39 UTSW 3 33,879,318 (GRCm39) splice site probably null
R7695:Ccdc39 UTSW 3 33,868,668 (GRCm39) missense probably damaging 1.00
R7752:Ccdc39 UTSW 3 33,886,766 (GRCm39) missense possibly damaging 0.55
R8487:Ccdc39 UTSW 3 33,886,808 (GRCm39) nonsense probably null
R8523:Ccdc39 UTSW 3 33,869,560 (GRCm39) critical splice donor site probably null
R8525:Ccdc39 UTSW 3 33,868,853 (GRCm39) missense probably benign 0.00
R8777:Ccdc39 UTSW 3 33,893,282 (GRCm39) missense probably benign
R8777-TAIL:Ccdc39 UTSW 3 33,893,282 (GRCm39) missense probably benign
R8842:Ccdc39 UTSW 3 33,880,612 (GRCm39) missense probably damaging 1.00
R8932:Ccdc39 UTSW 3 33,884,274 (GRCm39) missense probably benign 0.00
R8947:Ccdc39 UTSW 3 33,869,609 (GRCm39) unclassified probably benign
R9207:Ccdc39 UTSW 3 33,886,706 (GRCm39) nonsense probably null
R9280:Ccdc39 UTSW 3 33,870,153 (GRCm39) missense probably damaging 0.98
R9462:Ccdc39 UTSW 3 33,868,519 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCACTGTACAGAACTTTTGTC -3'
(R):5'- TTTGATCACTCTACCAAGCACC -3'

Sequencing Primer
(F):5'- GTACAGAACTTTTGTCTGCTCTG -3'
(R):5'- TGCCAATAGAAAGGTCTTTTTGAAG -3'
Posted On 2015-10-21