Incidental Mutation 'R4723:Slc10a4'
ID 354589
Institutional Source Beutler Lab
Gene Symbol Slc10a4
Ensembl Gene ENSMUSG00000029219
Gene Name solute carrier family 10 (sodium/bile acid cotransporter family), member 4
Synonyms
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 73164247-73170298 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73169398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 341 (V341E)
Ref Sequence ENSEMBL: ENSMUSP00000031127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031127] [ENSMUST00000201304]
AlphaFold Q3UEZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000031127
AA Change: V341E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031127
Gene: ENSMUSG00000029219
AA Change: V341E

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 42 55 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
Pfam:SBF 111 290 1e-37 PFAM
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200747
Predicted Effect probably damaging
Transcript: ENSMUST00000201304
AA Change: V142E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144062
Gene: ENSMUSG00000029219
AA Change: V142E

DomainStartEndE-ValueType
Pfam:SBF 1 91 1.7e-8 PFAM
transmembrane domain 101 123 N/A INTRINSIC
Meta Mutation Damage Score 0.3434 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit seizures and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Slc10a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Slc10a4 APN 5 73,169,263 (GRCm39) missense probably damaging 0.98
IGL01121:Slc10a4 APN 5 73,164,929 (GRCm39) missense probably damaging 0.99
IGL03324:Slc10a4 APN 5 73,169,286 (GRCm39) missense probably damaging 1.00
R1727:Slc10a4 UTSW 5 73,173,491 (GRCm39) unclassified probably benign
R1889:Slc10a4 UTSW 5 73,169,490 (GRCm39) missense possibly damaging 0.91
R2071:Slc10a4 UTSW 5 73,164,840 (GRCm39) missense probably damaging 1.00
R2091:Slc10a4 UTSW 5 73,174,482 (GRCm39) unclassified probably benign
R2137:Slc10a4 UTSW 5 73,164,923 (GRCm39) missense probably damaging 1.00
R2516:Slc10a4 UTSW 5 73,165,848 (GRCm39) missense possibly damaging 0.62
R5728:Slc10a4 UTSW 5 73,169,677 (GRCm39) missense probably damaging 0.99
R5838:Slc10a4 UTSW 5 73,169,373 (GRCm39) missense probably benign 0.00
R6175:Slc10a4 UTSW 5 73,169,593 (GRCm39) missense possibly damaging 0.60
R7375:Slc10a4 UTSW 5 73,169,650 (GRCm39) missense probably benign 0.00
R7682:Slc10a4 UTSW 5 73,164,453 (GRCm39) missense unknown
R9769:Slc10a4 UTSW 5 73,164,423 (GRCm39) missense unknown
X0066:Slc10a4 UTSW 5 73,165,848 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AATGACTGGCACCATGCTGG -3'
(R):5'- GAGGTGTCTGCCATTTCCTC -3'

Sequencing Primer
(F):5'- ACCATGCTGGGACCTGAACTG -3'
(R):5'- AAGAAATATCGGTGTCTTCGTCTTCG -3'
Posted On 2015-10-21