Incidental Mutation 'R4723:Sult2b1'
ID 354600
Institutional Source Beutler Lab
Gene Symbol Sult2b1
Ensembl Gene ENSMUSG00000003271
Gene Name sulfotransferase family, cytosolic, 2B, member 1
Synonyms SULT2B, Gm5897
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45379405-45409096 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45391489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 97 (Y97F)
Ref Sequence ENSEMBL: ENSMUSP00000147374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075571] [ENSMUST00000209739] [ENSMUST00000210754] [ENSMUST00000210147]
AlphaFold O35400
Predicted Effect probably damaging
Transcript: ENSMUST00000075571
AA Change: Y65F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075005
Gene: ENSMUSG00000003271
AA Change: Y65F

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 57 302 7.8e-84 PFAM
low complexity region 309 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107735
AA Change: Y99F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103363
Gene: ENSMUSG00000003271
AA Change: Y99F

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 91 336 5.2e-84 PFAM
Pfam:Sulfotransfer_3 92 262 5.1e-11 PFAM
low complexity region 343 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123250
AA Change: Y83F
Predicted Effect probably damaging
Transcript: ENSMUST00000140127
AA Change: Y61F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121262
Gene: ENSMUSG00000003271
AA Change: Y61F

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 53 130 2.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209435
Predicted Effect probably damaging
Transcript: ENSMUST00000209739
AA Change: Y97F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210754
AA Change: Y99F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210147
AA Change: Y61F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211176
Meta Mutation Damage Score 0.2404 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cholesterol sulfate in the dermis but otherwise appear to have normal lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Sult2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02415:Sult2b1 APN 7 45,391,509 (GRCm39) missense possibly damaging 0.86
IGL02964:Sult2b1 APN 7 45,384,698 (GRCm39) missense probably benign 0.01
IGL03208:Sult2b1 APN 7 45,383,053 (GRCm39) missense probably damaging 1.00
R0392:Sult2b1 UTSW 7 45,383,062 (GRCm39) missense probably damaging 1.00
R0415:Sult2b1 UTSW 7 45,379,516 (GRCm39) unclassified probably benign
R2247:Sult2b1 UTSW 7 45,384,734 (GRCm39) missense probably damaging 1.00
R3851:Sult2b1 UTSW 7 45,379,461 (GRCm39) unclassified probably benign
R3935:Sult2b1 UTSW 7 45,391,640 (GRCm39) missense probably benign 0.09
R3936:Sult2b1 UTSW 7 45,391,640 (GRCm39) missense probably benign 0.09
R4179:Sult2b1 UTSW 7 45,384,735 (GRCm39) missense probably damaging 1.00
R5634:Sult2b1 UTSW 7 45,383,506 (GRCm39) missense probably damaging 0.99
R5782:Sult2b1 UTSW 7 45,380,770 (GRCm39) missense probably damaging 1.00
R6562:Sult2b1 UTSW 7 45,391,670 (GRCm39) missense probably benign 0.00
R6816:Sult2b1 UTSW 7 45,383,102 (GRCm39) missense probably damaging 1.00
R6921:Sult2b1 UTSW 7 45,384,612 (GRCm39) missense probably damaging 1.00
R7145:Sult2b1 UTSW 7 45,383,056 (GRCm39) missense probably damaging 1.00
R7250:Sult2b1 UTSW 7 45,433,361 (GRCm39) missense unknown
R7392:Sult2b1 UTSW 7 45,391,862 (GRCm39) start gained probably benign
R7398:Sult2b1 UTSW 7 45,380,718 (GRCm39) missense probably damaging 1.00
R7691:Sult2b1 UTSW 7 45,384,708 (GRCm39) missense probably benign 0.01
R7712:Sult2b1 UTSW 7 45,379,620 (GRCm39) missense probably benign 0.15
R8239:Sult2b1 UTSW 7 45,433,361 (GRCm39) missense unknown
R9159:Sult2b1 UTSW 7 45,391,534 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTAGGCCTTCAGAGTCTCC -3'
(R):5'- GCTCAGAGAAAGGACACTCC -3'

Sequencing Primer
(F):5'- TTCAGAGTCTCCCTGGAGCAG -3'
(R):5'- ACTCCTCACTGGCGTGTGAATG -3'
Posted On 2015-10-21