Incidental Mutation 'R4723:Pde2a'
ID354601
Institutional Source Beutler Lab
Gene Symbol Pde2a
Ensembl Gene ENSMUSG00000110195
Gene Namephosphodiesterase 2A, cGMP-stimulated
Synonyms
MMRRC Submission 041959-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R4723 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101421691-101512827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 101494618 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 148 (P148R)
Ref Sequence ENSEMBL: ENSMUSP00000081956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084894] [ENSMUST00000163751] [ENSMUST00000166652] [ENSMUST00000209537] [ENSMUST00000210364] [ENSMUST00000211368]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084894
AA Change: P148R

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081956
Gene: ENSMUSG00000030653
AA Change: P148R

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163751
AA Change: P122R

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131553
Gene: ENSMUSG00000110195
AA Change: P122R

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 386 2.22e-17 SMART
GAF 408 557 6.11e-38 SMART
HDc 652 821 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166652
AA Change: P122R

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127521
Gene: ENSMUSG00000110195
AA Change: P122R

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209537
AA Change: P132R

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210100
Predicted Effect probably benign
Transcript: ENSMUST00000210364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211051
Predicted Effect probably benign
Transcript: ENSMUST00000211368
AA Change: P122R

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E17 and E18; another knock out mutation results in only some animals surviving to weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A T 8: 13,735,937 N69I probably damaging Het
Adgrv1 T C 13: 81,433,525 D4800G probably benign Het
Akna T C 4: 63,387,032 D499G probably benign Het
Arid1b A C 17: 5,337,290 I1673L probably benign Het
Bcr T A 10: 75,175,329 M24K probably benign Het
Bsn A G 9: 108,112,655 V1966A probably benign Het
Ccdc39 T C 3: 33,813,078 N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc6 G A 11: 98,908,831 probably null Het
Cmtm1 C T 8: 104,293,675 A371T probably damaging Het
Cmtm7 A C 9: 114,763,391 V46G possibly damaging Het
Cmtr1 A G 17: 29,687,157 probably null Het
Col5a3 T C 9: 20,809,591 H149R unknown Het
Coro7 T G 16: 4,631,994 Q634P probably benign Het
Crym A G 7: 120,201,075 probably null Het
Csmd3 A T 15: 47,669,160 F2546L probably benign Het
Dmap1 T C 4: 117,676,039 T273A probably benign Het
Dnah1 T C 14: 31,272,942 Y2786C probably damaging Het
Echs1 A C 7: 140,110,648 probably benign Het
Edem3 T A 1: 151,804,698 F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 I127V probably benign Het
Fam193a A G 5: 34,420,786 D208G probably benign Het
Farp2 T C 1: 93,580,899 V773A probably benign Het
Gas6 A G 8: 13,466,848 V550A probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2423 A G 13: 13,232,376 noncoding transcript Het
Grin1 T C 2: 25,294,470 S911G probably benign Het
Hkdc1 T C 10: 62,400,354 I470V probably benign Het
Hsdl2 T A 4: 59,593,270 probably benign Het
Iars2 A G 1: 185,315,979 Y519H probably damaging Het
Ikbkb A T 8: 22,669,607 M455K probably benign Het
Keap1 G T 9: 21,231,410 H516Q probably benign Het
Klk1b27 A T 7: 44,056,532 I220F probably damaging Het
Knop1 G A 7: 118,855,864 probably benign Het
Lhcgr T C 17: 88,742,602 T499A probably benign Het
Lrch3 A T 16: 32,988,484 probably null Het
Lrrc2 G A 9: 110,970,160 probably null Het
Lrrk2 T C 15: 91,764,759 L1652P probably damaging Het
Mbl1 T C 14: 41,154,558 V71A possibly damaging Het
Med8 T A 4: 118,411,801 M1K probably null Het
Mfsd2b A G 12: 4,868,992 L88P probably benign Het
Mkrn2 T A 6: 115,611,850 C185S probably damaging Het
Myo1d A G 11: 80,779,841 probably benign Het
Napg T G 18: 62,992,492 probably null Het
Ncor1 A G 11: 62,378,612 M253T probably benign Het
Oas3 T C 5: 120,766,256 T518A unknown Het
Obox3-ps8 A G 17: 36,453,144 noncoding transcript Het
Olfr519 A T 7: 108,893,821 F195L probably benign Het
Olfr656 T C 7: 104,618,489 V270A possibly damaging Het
Olfr71 T C 4: 43,705,785 K261R probably damaging Het
Opn5 A T 17: 42,607,200 M57K probably damaging Het
Prss56 C T 1: 87,185,337 L158F possibly damaging Het
Psmg3 G A 5: 139,826,370 probably benign Het
Rnase9 C T 14: 51,039,444 G26R probably damaging Het
Skint4 T C 4: 112,118,236 V131A possibly damaging Het
Slc10a4 T A 5: 73,012,055 V341E probably damaging Het
Slc16a14 T C 1: 84,913,020 Y188C probably damaging Het
Slc7a1 G T 5: 148,335,440 P476T probably damaging Het
Smchd1 A T 17: 71,436,747 C474* probably null Het
Smurf1 A T 5: 144,893,184 D336E probably damaging Het
Sox30 G A 11: 45,984,765 S448N probably benign Het
Spag11a G A 8: 19,159,382 V63I possibly damaging Het
Sprr1b T G 3: 92,437,293 K92T probably damaging Het
Stam2 T C 2: 52,720,950 Y20C probably benign Het
Sult2b1 T A 7: 45,742,065 Y97F probably damaging Het
Tecpr2 C T 12: 110,932,976 P593S probably benign Het
Tek T C 4: 94,799,160 V170A possibly damaging Het
Tiam2 A G 17: 3,450,317 Y891C probably benign Het
Tmem220 A G 11: 67,029,993 T75A possibly damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Txlnb A G 10: 17,799,267 H56R probably benign Het
Vmn2r98 A T 17: 19,066,340 N367Y probably benign Het
Vnn3 A G 10: 23,851,691 I36M possibly damaging Het
Zbtb7a G A 10: 81,144,440 R156H probably damaging Het
Other mutations in Pde2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Pde2a APN 7 101484589 nonsense probably null
IGL00731:Pde2a APN 7 101508099 missense probably benign 0.04
IGL00807:Pde2a APN 7 101504412 missense probably damaging 1.00
IGL01339:Pde2a APN 7 101507159 missense probably benign
IGL01503:Pde2a APN 7 101501936 splice site probably benign
IGL01646:Pde2a APN 7 101507711 missense possibly damaging 0.95
IGL01960:Pde2a APN 7 101504740 missense probably benign 0.40
IGL02281:Pde2a APN 7 101481392 missense probably benign 0.34
IGL02318:Pde2a APN 7 101503343 missense possibly damaging 0.79
IGL02479:Pde2a APN 7 101501083 missense probably damaging 1.00
IGL02632:Pde2a APN 7 101504656 missense probably damaging 1.00
IGL02725:Pde2a APN 7 101507218 missense probably null 0.00
IGL02888:Pde2a APN 7 101505069 missense probably damaging 0.98
IGL03027:Pde2a APN 7 101481420 missense probably benign 0.01
IGL03114:Pde2a APN 7 101508683 splice site probably benign
PIT1430001:Pde2a UTSW 7 101451477 splice site probably benign
PIT4131001:Pde2a UTSW 7 101511154 missense probably damaging 0.98
PIT4431001:Pde2a UTSW 7 101501897 missense probably damaging 1.00
R1170:Pde2a UTSW 7 101484543 missense probably benign 0.00
R1298:Pde2a UTSW 7 101507202 missense probably benign 0.12
R1300:Pde2a UTSW 7 101510404 missense possibly damaging 0.48
R1451:Pde2a UTSW 7 101421991 nonsense probably null
R1731:Pde2a UTSW 7 101501660 missense probably damaging 1.00
R1863:Pde2a UTSW 7 101511154 missense probably damaging 1.00
R2258:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2259:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2260:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R4179:Pde2a UTSW 7 101481383 makesense probably null
R4688:Pde2a UTSW 7 101502834 missense probably benign
R4717:Pde2a UTSW 7 101494672 missense probably benign 0.00
R4758:Pde2a UTSW 7 101511499 missense probably damaging 1.00
R4965:Pde2a UTSW 7 101502933 missense probably benign 0.01
R5034:Pde2a UTSW 7 101502024 missense probably benign 0.01
R5219:Pde2a UTSW 7 101504604 missense probably damaging 1.00
R5533:Pde2a UTSW 7 101505980 missense probably damaging 0.97
R6083:Pde2a UTSW 7 101502879 missense possibly damaging 0.93
R6114:Pde2a UTSW 7 101511112 critical splice acceptor site probably null
R6365:Pde2a UTSW 7 101510363 missense probably damaging 1.00
R6372:Pde2a UTSW 7 101481392 missense probably benign 0.34
R6395:Pde2a UTSW 7 101501035 missense probably benign 0.00
R6482:Pde2a UTSW 7 101501037 missense probably benign 0.11
R6492:Pde2a UTSW 7 101500442 missense possibly damaging 0.71
R6971:Pde2a UTSW 7 101510313 nonsense probably null
R7027:Pde2a UTSW 7 101511597 missense probably damaging 1.00
R7082:Pde2a UTSW 7 101508096 missense probably damaging 1.00
R7107:Pde2a UTSW 7 101421968 missense probably benign 0.01
R7142:Pde2a UTSW 7 101504650 missense probably damaging 1.00
R7203:Pde2a UTSW 7 101509944 missense possibly damaging 0.70
R7231:Pde2a UTSW 7 101505953 missense probably damaging 0.99
R7248:Pde2a UTSW 7 101503390 missense possibly damaging 0.88
R7570:Pde2a UTSW 7 101502834 missense probably benign 0.03
R7632:Pde2a UTSW 7 101484594 missense possibly damaging 0.64
R7658:Pde2a UTSW 7 101511581 missense possibly damaging 0.79
R8061:Pde2a UTSW 7 101503972 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCTCATGTCTGTCTCCAGGC -3'
(R):5'- GACAACTCCAGCCCCATCTG -3'

Sequencing Primer
(F):5'- AGCTCTGAAAGGAGTCTTGACCC -3'
(R):5'- TCAAGAAAGGCACTGTTGTCC -3'
Posted On2015-10-21