Incidental Mutation 'R4723:Pde2a'
ID 354601
Institutional Source Beutler Lab
Gene Symbol Pde2a
Ensembl Gene ENSMUSG00000110195
Gene Name phosphodiesterase 2A, cGMP-stimulated
Synonyms
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.807) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 101070905-101162026 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 101143825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 148 (P148R)
Ref Sequence ENSEMBL: ENSMUSP00000081956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084894] [ENSMUST00000163751] [ENSMUST00000166652] [ENSMUST00000209537] [ENSMUST00000210364] [ENSMUST00000211368]
AlphaFold Q922S4
Predicted Effect possibly damaging
Transcript: ENSMUST00000084894
AA Change: P148R

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081956
Gene: ENSMUSG00000030653
AA Change: P148R

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163751
AA Change: P122R

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131553
Gene: ENSMUSG00000110195
AA Change: P122R

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 386 2.22e-17 SMART
GAF 408 557 6.11e-38 SMART
HDc 652 821 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166652
AA Change: P122R

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127521
Gene: ENSMUSG00000110195
AA Change: P122R

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209537
AA Change: P132R

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210100
Predicted Effect probably benign
Transcript: ENSMUST00000210364
Predicted Effect probably benign
Transcript: ENSMUST00000211368
AA Change: P122R

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211051
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E17 and E18; another knock out mutation results in only some animals surviving to weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Pde2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Pde2a APN 7 101,133,796 (GRCm39) nonsense probably null
IGL00731:Pde2a APN 7 101,157,306 (GRCm39) missense probably benign 0.04
IGL00807:Pde2a APN 7 101,153,619 (GRCm39) missense probably damaging 1.00
IGL01339:Pde2a APN 7 101,156,366 (GRCm39) missense probably benign
IGL01503:Pde2a APN 7 101,151,143 (GRCm39) splice site probably benign
IGL01646:Pde2a APN 7 101,156,918 (GRCm39) missense possibly damaging 0.95
IGL01960:Pde2a APN 7 101,153,947 (GRCm39) missense probably benign 0.40
IGL02281:Pde2a APN 7 101,130,599 (GRCm39) missense probably benign 0.34
IGL02318:Pde2a APN 7 101,152,550 (GRCm39) missense possibly damaging 0.79
IGL02479:Pde2a APN 7 101,150,290 (GRCm39) missense probably damaging 1.00
IGL02632:Pde2a APN 7 101,153,863 (GRCm39) missense probably damaging 1.00
IGL02725:Pde2a APN 7 101,156,425 (GRCm39) missense probably null 0.00
IGL02888:Pde2a APN 7 101,154,276 (GRCm39) missense probably damaging 0.98
IGL03027:Pde2a APN 7 101,130,627 (GRCm39) missense probably benign 0.01
IGL03114:Pde2a APN 7 101,157,890 (GRCm39) splice site probably benign
PIT1430001:Pde2a UTSW 7 101,100,684 (GRCm39) splice site probably benign
PIT4131001:Pde2a UTSW 7 101,160,361 (GRCm39) missense probably damaging 0.98
PIT4431001:Pde2a UTSW 7 101,151,104 (GRCm39) missense probably damaging 1.00
R1170:Pde2a UTSW 7 101,133,750 (GRCm39) missense probably benign 0.00
R1298:Pde2a UTSW 7 101,156,409 (GRCm39) missense probably benign 0.12
R1300:Pde2a UTSW 7 101,159,611 (GRCm39) missense possibly damaging 0.48
R1451:Pde2a UTSW 7 101,071,198 (GRCm39) nonsense probably null
R1731:Pde2a UTSW 7 101,150,867 (GRCm39) missense probably damaging 1.00
R1863:Pde2a UTSW 7 101,160,361 (GRCm39) missense probably damaging 1.00
R2258:Pde2a UTSW 7 101,133,774 (GRCm39) missense probably damaging 1.00
R2259:Pde2a UTSW 7 101,133,774 (GRCm39) missense probably damaging 1.00
R2260:Pde2a UTSW 7 101,133,774 (GRCm39) missense probably damaging 1.00
R4179:Pde2a UTSW 7 101,130,590 (GRCm39) makesense probably null
R4688:Pde2a UTSW 7 101,152,041 (GRCm39) missense probably benign
R4717:Pde2a UTSW 7 101,143,879 (GRCm39) missense probably benign 0.00
R4758:Pde2a UTSW 7 101,160,706 (GRCm39) missense probably damaging 1.00
R4965:Pde2a UTSW 7 101,152,140 (GRCm39) missense probably benign 0.01
R5034:Pde2a UTSW 7 101,151,231 (GRCm39) missense probably benign 0.01
R5219:Pde2a UTSW 7 101,153,811 (GRCm39) missense probably damaging 1.00
R5533:Pde2a UTSW 7 101,155,187 (GRCm39) missense probably damaging 0.97
R6083:Pde2a UTSW 7 101,152,086 (GRCm39) missense possibly damaging 0.93
R6114:Pde2a UTSW 7 101,160,319 (GRCm39) critical splice acceptor site probably null
R6365:Pde2a UTSW 7 101,159,570 (GRCm39) missense probably damaging 1.00
R6372:Pde2a UTSW 7 101,130,599 (GRCm39) missense probably benign 0.34
R6395:Pde2a UTSW 7 101,150,242 (GRCm39) missense probably benign 0.00
R6482:Pde2a UTSW 7 101,150,244 (GRCm39) missense probably benign 0.11
R6492:Pde2a UTSW 7 101,149,649 (GRCm39) missense possibly damaging 0.71
R6971:Pde2a UTSW 7 101,159,520 (GRCm39) nonsense probably null
R7027:Pde2a UTSW 7 101,160,804 (GRCm39) missense probably damaging 1.00
R7082:Pde2a UTSW 7 101,157,303 (GRCm39) missense probably damaging 1.00
R7107:Pde2a UTSW 7 101,071,175 (GRCm39) missense probably benign 0.01
R7142:Pde2a UTSW 7 101,153,857 (GRCm39) missense probably damaging 1.00
R7203:Pde2a UTSW 7 101,159,151 (GRCm39) missense possibly damaging 0.70
R7231:Pde2a UTSW 7 101,155,160 (GRCm39) missense probably damaging 0.99
R7248:Pde2a UTSW 7 101,152,597 (GRCm39) missense possibly damaging 0.88
R7570:Pde2a UTSW 7 101,152,041 (GRCm39) missense probably benign 0.03
R7632:Pde2a UTSW 7 101,133,801 (GRCm39) missense possibly damaging 0.64
R7658:Pde2a UTSW 7 101,160,788 (GRCm39) missense possibly damaging 0.79
R8061:Pde2a UTSW 7 101,153,179 (GRCm39) missense probably benign 0.29
R8098:Pde2a UTSW 7 101,071,178 (GRCm39) missense probably benign
R8165:Pde2a UTSW 7 101,149,655 (GRCm39) critical splice donor site probably null
R8297:Pde2a UTSW 7 101,153,880 (GRCm39) missense possibly damaging 0.86
R8513:Pde2a UTSW 7 101,158,972 (GRCm39) missense probably damaging 1.00
R8708:Pde2a UTSW 7 101,159,588 (GRCm39) missense probably damaging 1.00
R8794:Pde2a UTSW 7 101,155,136 (GRCm39) missense possibly damaging 0.89
R9045:Pde2a UTSW 7 101,152,498 (GRCm39) missense unknown
R9054:Pde2a UTSW 7 101,156,927 (GRCm39) missense probably damaging 1.00
R9344:Pde2a UTSW 7 101,144,891 (GRCm39) missense possibly damaging 0.88
R9367:Pde2a UTSW 7 101,160,361 (GRCm39) missense probably damaging 1.00
R9590:Pde2a UTSW 7 101,160,757 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CCTCATGTCTGTCTCCAGGC -3'
(R):5'- GACAACTCCAGCCCCATCTG -3'

Sequencing Primer
(F):5'- AGCTCTGAAAGGAGTCTTGACCC -3'
(R):5'- TCAAGAAAGGCACTGTTGTCC -3'
Posted On 2015-10-21