Incidental Mutation 'R4723:Or10a3n'
ID 354603
Institutional Source Beutler Lab
Gene Symbol Or10a3n
Ensembl Gene ENSMUSG00000066239
Gene Name olfactory receptor family 10 subfamily A member 3N
Synonyms GA_x6K02T2PBJ9-11224559-11223615, MOR268-6, Olfr519
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 108492668-108493612 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108493028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 195 (F195L)
Ref Sequence ENSEMBL: ENSMUSP00000144271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084752] [ENSMUST00000202706]
AlphaFold K7N645
Predicted Effect probably benign
Transcript: ENSMUST00000084752
AA Change: F200L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000081804
Gene: ENSMUSG00000066239
AA Change: F200L

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.3e-59 PFAM
Pfam:7TM_GPCR_Srsx 40 310 3.3e-6 PFAM
Pfam:7tm_1 46 305 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202706
AA Change: F195L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144271
Gene: ENSMUSG00000066239
AA Change: F195L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-5 PFAM
Pfam:7tm_1 41 300 1.2e-24 PFAM
Meta Mutation Damage Score 0.1980 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Or10a3n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Or10a3n APN 7 108,493,292 (GRCm39) missense probably benign 0.22
IGL02043:Or10a3n APN 7 108,493,046 (GRCm39) nonsense probably null
PIT4382001:Or10a3n UTSW 7 108,493,309 (GRCm39) missense probably damaging 1.00
R1183:Or10a3n UTSW 7 108,492,948 (GRCm39) missense probably damaging 1.00
R1596:Or10a3n UTSW 7 108,493,086 (GRCm39) missense probably damaging 1.00
R1647:Or10a3n UTSW 7 108,492,972 (GRCm39) missense probably damaging 1.00
R1648:Or10a3n UTSW 7 108,492,972 (GRCm39) missense probably damaging 1.00
R3952:Or10a3n UTSW 7 108,493,189 (GRCm39) missense probably benign 0.00
R4611:Or10a3n UTSW 7 108,493,324 (GRCm39) missense probably damaging 1.00
R5838:Or10a3n UTSW 7 108,493,292 (GRCm39) missense probably benign 0.22
R6483:Or10a3n UTSW 7 108,493,318 (GRCm39) missense possibly damaging 0.76
R6516:Or10a3n UTSW 7 108,492,972 (GRCm39) missense probably damaging 1.00
R7353:Or10a3n UTSW 7 108,493,429 (GRCm39) missense probably damaging 1.00
R7748:Or10a3n UTSW 7 108,493,285 (GRCm39) missense probably benign 0.22
R7975:Or10a3n UTSW 7 108,493,019 (GRCm39) nonsense probably null
R8823:Or10a3n UTSW 7 108,493,155 (GRCm39) missense probably benign 0.00
R8913:Or10a3n UTSW 7 108,492,736 (GRCm39) missense probably damaging 0.99
R8914:Or10a3n UTSW 7 108,492,736 (GRCm39) missense probably damaging 0.99
R9066:Or10a3n UTSW 7 108,493,253 (GRCm39) nonsense probably null
R9093:Or10a3n UTSW 7 108,493,609 (GRCm39) missense probably benign 0.05
R9763:Or10a3n UTSW 7 108,493,210 (GRCm39) missense probably benign 0.01
Z1088:Or10a3n UTSW 7 108,492,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGCCATAGAAGAGGATGAC -3'
(R):5'- ATCGATTTGCTGCAATCTGCC -3'

Sequencing Primer
(F):5'- CAGAGGTGAGATGAGAGGCACAC -3'
(R):5'- TGACCTACCCAGTGATTATGAGC -3'
Posted On 2015-10-21