Incidental Mutation 'R4723:Olfr519'
ID354603
Institutional Source Beutler Lab
Gene Symbol Olfr519
Ensembl Gene ENSMUSG00000066239
Gene Nameolfactory receptor 519
SynonymsGA_x6K02T2PBJ9-11224559-11223615, MOR268-6
MMRRC Submission 041959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4723 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108893461-108894420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108893821 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 195 (F195L)
Ref Sequence ENSEMBL: ENSMUSP00000144271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084752] [ENSMUST00000202706]
Predicted Effect probably benign
Transcript: ENSMUST00000084752
AA Change: F200L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000081804
Gene: ENSMUSG00000066239
AA Change: F200L

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.3e-59 PFAM
Pfam:7TM_GPCR_Srsx 40 310 3.3e-6 PFAM
Pfam:7tm_1 46 305 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202706
AA Change: F195L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144271
Gene: ENSMUSG00000066239
AA Change: F195L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-5 PFAM
Pfam:7tm_1 41 300 1.2e-24 PFAM
Meta Mutation Damage Score 0.1980 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A T 8: 13,735,937 N69I probably damaging Het
Adgrv1 T C 13: 81,433,525 D4800G probably benign Het
Akna T C 4: 63,387,032 D499G probably benign Het
Arid1b A C 17: 5,337,290 I1673L probably benign Het
Bcr T A 10: 75,175,329 M24K probably benign Het
Bsn A G 9: 108,112,655 V1966A probably benign Het
Ccdc39 T C 3: 33,813,078 N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc6 G A 11: 98,908,831 probably null Het
Cmtm1 C T 8: 104,293,675 A371T probably damaging Het
Cmtm7 A C 9: 114,763,391 V46G possibly damaging Het
Cmtr1 A G 17: 29,687,157 probably null Het
Col5a3 T C 9: 20,809,591 H149R unknown Het
Coro7 T G 16: 4,631,994 Q634P probably benign Het
Crym A G 7: 120,201,075 probably null Het
Csmd3 A T 15: 47,669,160 F2546L probably benign Het
Dmap1 T C 4: 117,676,039 T273A probably benign Het
Dnah1 T C 14: 31,272,942 Y2786C probably damaging Het
Echs1 A C 7: 140,110,648 probably benign Het
Edem3 T A 1: 151,804,698 F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 I127V probably benign Het
Fam193a A G 5: 34,420,786 D208G probably benign Het
Farp2 T C 1: 93,580,899 V773A probably benign Het
Gas6 A G 8: 13,466,848 V550A probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2423 A G 13: 13,232,376 noncoding transcript Het
Grin1 T C 2: 25,294,470 S911G probably benign Het
Hkdc1 T C 10: 62,400,354 I470V probably benign Het
Hsdl2 T A 4: 59,593,270 probably benign Het
Iars2 A G 1: 185,315,979 Y519H probably damaging Het
Ikbkb A T 8: 22,669,607 M455K probably benign Het
Keap1 G T 9: 21,231,410 H516Q probably benign Het
Klk1b27 A T 7: 44,056,532 I220F probably damaging Het
Knop1 G A 7: 118,855,864 probably benign Het
Lhcgr T C 17: 88,742,602 T499A probably benign Het
Lrch3 A T 16: 32,988,484 probably null Het
Lrrc2 G A 9: 110,970,160 probably null Het
Lrrk2 T C 15: 91,764,759 L1652P probably damaging Het
Mbl1 T C 14: 41,154,558 V71A possibly damaging Het
Med8 T A 4: 118,411,801 M1K probably null Het
Mfsd2b A G 12: 4,868,992 L88P probably benign Het
Mkrn2 T A 6: 115,611,850 C185S probably damaging Het
Myo1d A G 11: 80,779,841 probably benign Het
Napg T G 18: 62,992,492 probably null Het
Ncor1 A G 11: 62,378,612 M253T probably benign Het
Oas3 T C 5: 120,766,256 T518A unknown Het
Obox3-ps8 A G 17: 36,453,144 noncoding transcript Het
Olfr656 T C 7: 104,618,489 V270A possibly damaging Het
Olfr71 T C 4: 43,705,785 K261R probably damaging Het
Opn5 A T 17: 42,607,200 M57K probably damaging Het
Pde2a C G 7: 101,494,618 P148R possibly damaging Het
Prss56 C T 1: 87,185,337 L158F possibly damaging Het
Psmg3 G A 5: 139,826,370 probably benign Het
Rnase9 C T 14: 51,039,444 G26R probably damaging Het
Skint4 T C 4: 112,118,236 V131A possibly damaging Het
Slc10a4 T A 5: 73,012,055 V341E probably damaging Het
Slc16a14 T C 1: 84,913,020 Y188C probably damaging Het
Slc7a1 G T 5: 148,335,440 P476T probably damaging Het
Smchd1 A T 17: 71,436,747 C474* probably null Het
Smurf1 A T 5: 144,893,184 D336E probably damaging Het
Sox30 G A 11: 45,984,765 S448N probably benign Het
Spag11a G A 8: 19,159,382 V63I possibly damaging Het
Sprr1b T G 3: 92,437,293 K92T probably damaging Het
Stam2 T C 2: 52,720,950 Y20C probably benign Het
Sult2b1 T A 7: 45,742,065 Y97F probably damaging Het
Tecpr2 C T 12: 110,932,976 P593S probably benign Het
Tek T C 4: 94,799,160 V170A possibly damaging Het
Tiam2 A G 17: 3,450,317 Y891C probably benign Het
Tmem220 A G 11: 67,029,993 T75A possibly damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Txlnb A G 10: 17,799,267 H56R probably benign Het
Vmn2r98 A T 17: 19,066,340 N367Y probably benign Het
Vnn3 A G 10: 23,851,691 I36M possibly damaging Het
Zbtb7a G A 10: 81,144,440 R156H probably damaging Het
Other mutations in Olfr519
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Olfr519 APN 7 108894085 missense probably benign 0.22
IGL02043:Olfr519 APN 7 108893839 nonsense probably null
PIT4382001:Olfr519 UTSW 7 108894102 missense probably damaging 1.00
R1183:Olfr519 UTSW 7 108893741 missense probably damaging 1.00
R1596:Olfr519 UTSW 7 108893879 missense probably damaging 1.00
R1647:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R1648:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R3952:Olfr519 UTSW 7 108893982 missense probably benign 0.00
R4611:Olfr519 UTSW 7 108894117 missense probably damaging 1.00
R5838:Olfr519 UTSW 7 108894085 missense probably benign 0.22
R6483:Olfr519 UTSW 7 108894111 missense possibly damaging 0.76
R6516:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R7353:Olfr519 UTSW 7 108894222 missense probably damaging 1.00
R7748:Olfr519 UTSW 7 108894078 missense probably benign 0.22
R7975:Olfr519 UTSW 7 108893812 nonsense probably null
Z1088:Olfr519 UTSW 7 108893773 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGCCATAGAAGAGGATGAC -3'
(R):5'- ATCGATTTGCTGCAATCTGCC -3'

Sequencing Primer
(F):5'- CAGAGGTGAGATGAGAGGCACAC -3'
(R):5'- TGACCTACCCAGTGATTATGAGC -3'
Posted On2015-10-21