Incidental Mutation 'R4723:Txlnb'
ID354612
Institutional Source Beutler Lab
Gene Symbol Txlnb
Ensembl Gene ENSMUSG00000039891
Gene Nametaxilin beta
Synonyms2310001N14Rik, Mdp77
MMRRC Submission 041959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4723 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location17796226-17845665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17799267 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 56 (H56R)
Ref Sequence ENSEMBL: ENSMUSP00000044936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037964]
Predicted Effect probably benign
Transcript: ENSMUST00000037964
AA Change: H56R

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000044936
Gene: ENSMUSG00000039891
AA Change: H56R

DomainStartEndE-ValueType
internal_repeat_2 5 22 2.13e-6 PROSPERO
internal_repeat_1 25 93 4.27e-8 PROSPERO
low complexity region 115 128 N/A INTRINSIC
Pfam:Taxilin 145 454 3.1e-122 PFAM
low complexity region 477 491 N/A INTRINSIC
internal_repeat_2 543 560 2.13e-6 PROSPERO
low complexity region 575 591 N/A INTRINSIC
internal_repeat_1 600 659 4.27e-8 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181428
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A T 8: 13,735,937 N69I probably damaging Het
Adgrv1 T C 13: 81,433,525 D4800G probably benign Het
Akna T C 4: 63,387,032 D499G probably benign Het
Arid1b A C 17: 5,337,290 I1673L probably benign Het
Bcr T A 10: 75,175,329 M24K probably benign Het
Bsn A G 9: 108,112,655 V1966A probably benign Het
Ccdc39 T C 3: 33,813,078 N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc6 G A 11: 98,908,831 probably null Het
Cmtm1 C T 8: 104,293,675 A371T probably damaging Het
Cmtm7 A C 9: 114,763,391 V46G possibly damaging Het
Cmtr1 A G 17: 29,687,157 probably null Het
Col5a3 T C 9: 20,809,591 H149R unknown Het
Coro7 T G 16: 4,631,994 Q634P probably benign Het
Crym A G 7: 120,201,075 probably null Het
Csmd3 A T 15: 47,669,160 F2546L probably benign Het
Dmap1 T C 4: 117,676,039 T273A probably benign Het
Dnah1 T C 14: 31,272,942 Y2786C probably damaging Het
Echs1 A C 7: 140,110,648 probably benign Het
Edem3 T A 1: 151,804,698 F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 I127V probably benign Het
Fam193a A G 5: 34,420,786 D208G probably benign Het
Farp2 T C 1: 93,580,899 V773A probably benign Het
Gas6 A G 8: 13,466,848 V550A probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2423 A G 13: 13,232,376 noncoding transcript Het
Grin1 T C 2: 25,294,470 S911G probably benign Het
Hkdc1 T C 10: 62,400,354 I470V probably benign Het
Hsdl2 T A 4: 59,593,270 probably benign Het
Iars2 A G 1: 185,315,979 Y519H probably damaging Het
Ikbkb A T 8: 22,669,607 M455K probably benign Het
Keap1 G T 9: 21,231,410 H516Q probably benign Het
Klk1b27 A T 7: 44,056,532 I220F probably damaging Het
Knop1 G A 7: 118,855,864 probably benign Het
Lhcgr T C 17: 88,742,602 T499A probably benign Het
Lrch3 A T 16: 32,988,484 probably null Het
Lrrc2 G A 9: 110,970,160 probably null Het
Lrrk2 T C 15: 91,764,759 L1652P probably damaging Het
Mbl1 T C 14: 41,154,558 V71A possibly damaging Het
Med8 T A 4: 118,411,801 M1K probably null Het
Mfsd2b A G 12: 4,868,992 L88P probably benign Het
Mkrn2 T A 6: 115,611,850 C185S probably damaging Het
Myo1d A G 11: 80,779,841 probably benign Het
Napg T G 18: 62,992,492 probably null Het
Ncor1 A G 11: 62,378,612 M253T probably benign Het
Oas3 T C 5: 120,766,256 T518A unknown Het
Obox3-ps8 A G 17: 36,453,144 noncoding transcript Het
Olfr519 A T 7: 108,893,821 F195L probably benign Het
Olfr656 T C 7: 104,618,489 V270A possibly damaging Het
Olfr71 T C 4: 43,705,785 K261R probably damaging Het
Opn5 A T 17: 42,607,200 M57K probably damaging Het
Pde2a C G 7: 101,494,618 P148R possibly damaging Het
Prss56 C T 1: 87,185,337 L158F possibly damaging Het
Psmg3 G A 5: 139,826,370 probably benign Het
Rnase9 C T 14: 51,039,444 G26R probably damaging Het
Skint4 T C 4: 112,118,236 V131A possibly damaging Het
Slc10a4 T A 5: 73,012,055 V341E probably damaging Het
Slc16a14 T C 1: 84,913,020 Y188C probably damaging Het
Slc7a1 G T 5: 148,335,440 P476T probably damaging Het
Smchd1 A T 17: 71,436,747 C474* probably null Het
Smurf1 A T 5: 144,893,184 D336E probably damaging Het
Sox30 G A 11: 45,984,765 S448N probably benign Het
Spag11a G A 8: 19,159,382 V63I possibly damaging Het
Sprr1b T G 3: 92,437,293 K92T probably damaging Het
Stam2 T C 2: 52,720,950 Y20C probably benign Het
Sult2b1 T A 7: 45,742,065 Y97F probably damaging Het
Tecpr2 C T 12: 110,932,976 P593S probably benign Het
Tek T C 4: 94,799,160 V170A possibly damaging Het
Tiam2 A G 17: 3,450,317 Y891C probably benign Het
Tmem220 A G 11: 67,029,993 T75A possibly damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Vmn2r98 A T 17: 19,066,340 N367Y probably benign Het
Vnn3 A G 10: 23,851,691 I36M possibly damaging Het
Zbtb7a G A 10: 81,144,440 R156H probably damaging Het
Other mutations in Txlnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Txlnb APN 10 17842963 missense probably damaging 0.98
IGL01820:Txlnb APN 10 17806858 critical splice donor site probably null
IGL02244:Txlnb APN 10 17843368 missense probably benign 0.00
IGL02247:Txlnb APN 10 17830342 missense possibly damaging 0.55
IGL02247:Txlnb APN 10 17841528 splice site probably benign
IGL02931:Txlnb APN 10 17827982 missense probably damaging 1.00
IGL03006:Txlnb APN 10 17838975 missense probably damaging 0.96
IGL02991:Txlnb UTSW 10 17841453 missense probably damaging 1.00
R0092:Txlnb UTSW 10 17842755 missense possibly damaging 0.91
R0800:Txlnb UTSW 10 17799492 missense possibly damaging 0.50
R0908:Txlnb UTSW 10 17799177 missense probably damaging 1.00
R1172:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1174:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1340:Txlnb UTSW 10 17842740 missense probably damaging 1.00
R1373:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1641:Txlnb UTSW 10 17806773 missense possibly damaging 0.55
R1680:Txlnb UTSW 10 17843233 missense probably benign 0.01
R1710:Txlnb UTSW 10 17843455 missense possibly damaging 0.90
R1741:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1955:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R2031:Txlnb UTSW 10 17830314 missense possibly damaging 0.85
R4300:Txlnb UTSW 10 17827925 missense probably damaging 1.00
R4483:Txlnb UTSW 10 17838997 nonsense probably null
R4484:Txlnb UTSW 10 17838997 nonsense probably null
R4656:Txlnb UTSW 10 17815276 missense probably damaging 1.00
R4664:Txlnb UTSW 10 17843194 missense probably damaging 0.99
R4974:Txlnb UTSW 10 17838969 missense probably damaging 1.00
R5291:Txlnb UTSW 10 17799396 missense possibly damaging 0.92
R5538:Txlnb UTSW 10 17838909 missense probably damaging 1.00
R5791:Txlnb UTSW 10 17799128 missense probably benign 0.01
R5967:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R6144:Txlnb UTSW 10 17843166 missense probably benign 0.17
R6212:Txlnb UTSW 10 17799309 missense probably damaging 1.00
R7146:Txlnb UTSW 10 17827798 missense possibly damaging 0.81
R7171:Txlnb UTSW 10 17842984 missense probably benign 0.22
R7253:Txlnb UTSW 10 17827885 missense probably damaging 1.00
R7468:Txlnb UTSW 10 17799334 missense probably damaging 0.96
R7608:Txlnb UTSW 10 17815398 missense probably damaging 0.98
R7936:Txlnb UTSW 10 17827964 missense probably benign 0.26
R8245:Txlnb UTSW 10 17841457 missense probably damaging 1.00
R8262:Txlnb UTSW 10 17843004 missense possibly damaging 0.90
R8435:Txlnb UTSW 10 17827796 missense probably damaging 1.00
R8933:Txlnb UTSW 10 17806798 missense probably damaging 0.97
X0025:Txlnb UTSW 10 17799422 missense probably benign 0.39
Z1177:Txlnb UTSW 10 17806806 missense probably benign 0.33
Z1177:Txlnb UTSW 10 17827804 missense probably damaging 1.00
Z1177:Txlnb UTSW 10 17833308 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GAACCATGACTGTGCTTCCC -3'
(R):5'- TCTTCAGGAGCAGTGGGTTCTC -3'

Sequencing Primer
(F):5'- ATGACTGTGCTTCCCACCAGAC -3'
(R):5'- AGCAGTGGGTTCTCTGTCTATCTC -3'
Posted On2015-10-21