Incidental Mutation 'R4723:Zbtb7a'
ID 354616
Institutional Source Beutler Lab
Gene Symbol Zbtb7a
Ensembl Gene ENSMUSG00000035011
Gene Name zinc finger and BTB domain containing 7a
Synonyms Zbtb7, 9130006G12Rik, Lrf, 9030619K07Rik, FBI-1, Leukemia/lymphoma Related Factor, Pokemon
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80971113-80988056 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80980274 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 156 (R156H)
Ref Sequence ENSEMBL: ENSMUSP00000114470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048128] [ENSMUST00000117956] [ENSMUST00000119606] [ENSMUST00000121840] [ENSMUST00000125261] [ENSMUST00000146895]
AlphaFold O88939
Predicted Effect probably damaging
Transcript: ENSMUST00000048128
AA Change: R156H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047333
Gene: ENSMUSG00000035011
AA Change: R156H

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117956
AA Change: R156H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113428
Gene: ENSMUSG00000035011
AA Change: R156H

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119606
AA Change: R156H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113612
Gene: ENSMUSG00000035011
AA Change: R156H

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121840
AA Change: R156H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113787
Gene: ENSMUSG00000035011
AA Change: R156H

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125261
AA Change: R156H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114470
Gene: ENSMUSG00000035011
AA Change: R156H

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146895
Meta Mutation Damage Score 0.2267 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die around E16.5 due to anemia and exhibit a cell autonomous defect in early B cell development. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(54)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Other mutations in Zbtb7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02937:Zbtb7a APN 10 80,980,132 (GRCm39) missense probably benign 0.30
Bushel UTSW 10 80,984,163 (GRCm39) missense probably benign 0.01
dram UTSW 10 80,980,100 (GRCm39) missense probably damaging 1.00
Gallon UTSW 10 80,980,274 (GRCm39) missense probably damaging 1.00
peck UTSW 10 80,979,820 (GRCm39) missense probably damaging 1.00
D6062:Zbtb7a UTSW 10 80,980,192 (GRCm39) missense probably damaging 0.99
R0529:Zbtb7a UTSW 10 80,979,820 (GRCm39) missense probably damaging 1.00
R0562:Zbtb7a UTSW 10 80,984,163 (GRCm39) missense probably benign 0.01
R2045:Zbtb7a UTSW 10 80,980,244 (GRCm39) missense probably benign 0.03
R2275:Zbtb7a UTSW 10 80,980,831 (GRCm39) missense possibly damaging 0.95
R3755:Zbtb7a UTSW 10 80,980,100 (GRCm39) missense probably damaging 1.00
R3883:Zbtb7a UTSW 10 80,983,859 (GRCm39) missense probably damaging 1.00
R5503:Zbtb7a UTSW 10 80,980,631 (GRCm39) missense probably damaging 0.96
R5650:Zbtb7a UTSW 10 80,980,883 (GRCm39) missense probably damaging 1.00
R6872:Zbtb7a UTSW 10 80,983,905 (GRCm39) missense possibly damaging 0.95
R7196:Zbtb7a UTSW 10 80,980,434 (GRCm39) missense probably damaging 0.99
R7558:Zbtb7a UTSW 10 80,984,269 (GRCm39) makesense probably null
R7602:Zbtb7a UTSW 10 80,980,010 (GRCm39) missense probably damaging 0.99
R8220:Zbtb7a UTSW 10 80,980,838 (GRCm39) missense probably damaging 0.99
R8317:Zbtb7a UTSW 10 80,980,784 (GRCm39) missense probably benign 0.18
R8552:Zbtb7a UTSW 10 80,980,141 (GRCm39) missense probably damaging 1.00
R8930:Zbtb7a UTSW 10 80,980,368 (GRCm39) missense probably benign 0.04
R8932:Zbtb7a UTSW 10 80,980,368 (GRCm39) missense probably benign 0.04
R9782:Zbtb7a UTSW 10 80,979,910 (GRCm39) missense probably damaging 0.99
R9792:Zbtb7a UTSW 10 80,980,378 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGATCGACTTCGTGAGTGCC -3'
(R):5'- AAGTCCAAGCCATTGCAGTC -3'

Sequencing Primer
(F):5'- ATGGACTTCGCCTACACCG -3'
(R):5'- AAGCCATTGCAGTCGCCTG -3'
Posted On 2015-10-21