Incidental Mutation 'R4723:Lrch3'
ID 354630
Institutional Source Beutler Lab
Gene Symbol Lrch3
Ensembl Gene ENSMUSG00000022801
Gene Name leucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms LOC385628, 2210409B11Rik
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 32734470-32836017 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 32808854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023491] [ENSMUST00000135193] [ENSMUST00000170201] [ENSMUST00000165616] [ENSMUST00000170899] [ENSMUST00000165826]
AlphaFold Q8BVU0
Predicted Effect probably null
Transcript: ENSMUST00000023491
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably null
Transcript: ENSMUST00000135193
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142290
SMART Domains Protein: ENSMUSP00000117302
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
SCOP:d1h67a_ 201 253 1e-11 SMART
Blast:CH 205 253 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156928
Predicted Effect probably null
Transcript: ENSMUST00000163428
SMART Domains Protein: ENSMUSP00000133034
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 122 137 N/A INTRINSIC
SCOP:d1h67a_ 230 265 9e-5 SMART
Blast:CH 234 265 7e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000170201
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165616
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170899
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171118
SMART Domains Protein: ENSMUSP00000130392
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165826
SMART Domains Protein: ENSMUSP00000126308
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Lrch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lrch3 APN 16 32,815,335 (GRCm39) missense probably benign 0.10
IGL01400:Lrch3 APN 16 32,799,911 (GRCm39) missense probably damaging 1.00
IGL02565:Lrch3 APN 16 32,826,084 (GRCm39) missense probably benign 0.00
IGL03076:Lrch3 APN 16 32,802,223 (GRCm39) missense possibly damaging 0.52
IGL03103:Lrch3 APN 16 32,772,507 (GRCm39) missense probably damaging 1.00
IGL03125:Lrch3 APN 16 32,734,647 (GRCm39) missense possibly damaging 0.83
IGL03349:Lrch3 APN 16 32,775,694 (GRCm39) missense probably damaging 1.00
eluted UTSW 16 32,806,377 (GRCm39) missense probably null
leached UTSW 16 32,779,833 (GRCm39) missense probably damaging 1.00
R0054:Lrch3 UTSW 16 32,816,222 (GRCm39) intron probably benign
R0123:Lrch3 UTSW 16 32,782,124 (GRCm39) splice site probably benign
R0225:Lrch3 UTSW 16 32,782,124 (GRCm39) splice site probably benign
R0326:Lrch3 UTSW 16 32,799,870 (GRCm39) missense probably damaging 1.00
R0455:Lrch3 UTSW 16 32,807,250 (GRCm39) missense probably damaging 0.99
R0734:Lrch3 UTSW 16 32,817,853 (GRCm39) nonsense probably null
R1204:Lrch3 UTSW 16 32,829,584 (GRCm39) missense probably damaging 1.00
R1470:Lrch3 UTSW 16 32,808,865 (GRCm39) splice site probably benign
R1526:Lrch3 UTSW 16 32,770,746 (GRCm39) missense probably damaging 1.00
R1597:Lrch3 UTSW 16 32,770,781 (GRCm39) nonsense probably null
R1850:Lrch3 UTSW 16 32,807,163 (GRCm39) missense probably benign 0.01
R1966:Lrch3 UTSW 16 32,734,755 (GRCm39) missense possibly damaging 0.94
R2241:Lrch3 UTSW 16 32,816,211 (GRCm39) missense probably damaging 0.99
R2313:Lrch3 UTSW 16 32,782,045 (GRCm39) missense probably damaging 1.00
R2902:Lrch3 UTSW 16 32,770,766 (GRCm39) missense probably damaging 1.00
R4795:Lrch3 UTSW 16 32,826,074 (GRCm39) missense probably damaging 1.00
R4970:Lrch3 UTSW 16 32,818,883 (GRCm39) missense probably damaging 1.00
R5223:Lrch3 UTSW 16 32,734,767 (GRCm39) missense probably damaging 0.99
R5292:Lrch3 UTSW 16 32,796,177 (GRCm39) missense probably damaging 1.00
R5414:Lrch3 UTSW 16 32,806,335 (GRCm39) splice site probably null
R5470:Lrch3 UTSW 16 32,818,960 (GRCm39) missense probably damaging 1.00
R5594:Lrch3 UTSW 16 32,734,554 (GRCm39) missense probably damaging 0.99
R5843:Lrch3 UTSW 16 32,818,896 (GRCm39) missense probably damaging 1.00
R5862:Lrch3 UTSW 16 32,816,179 (GRCm39) missense probably damaging 1.00
R5911:Lrch3 UTSW 16 32,779,833 (GRCm39) missense probably damaging 1.00
R5932:Lrch3 UTSW 16 32,796,106 (GRCm39) missense probably damaging 1.00
R6519:Lrch3 UTSW 16 32,815,367 (GRCm39) critical splice donor site probably benign
R6731:Lrch3 UTSW 16 32,770,790 (GRCm39) missense probably damaging 1.00
R7182:Lrch3 UTSW 16 32,814,149 (GRCm39) missense probably benign 0.05
R7197:Lrch3 UTSW 16 32,810,665 (GRCm39) missense probably damaging 1.00
R7319:Lrch3 UTSW 16 32,815,363 (GRCm39) missense probably benign 0.19
R7392:Lrch3 UTSW 16 32,807,125 (GRCm39) nonsense probably null
R7408:Lrch3 UTSW 16 32,807,113 (GRCm39) nonsense probably null
R7414:Lrch3 UTSW 16 32,818,883 (GRCm39) missense probably damaging 1.00
R7425:Lrch3 UTSW 16 32,826,077 (GRCm39) missense probably damaging 1.00
R7909:Lrch3 UTSW 16 32,829,663 (GRCm39) missense probably benign 0.00
R7956:Lrch3 UTSW 16 32,806,377 (GRCm39) missense probably null
R8009:Lrch3 UTSW 16 32,826,083 (GRCm39) missense possibly damaging 0.72
R8247:Lrch3 UTSW 16 32,829,713 (GRCm39) nonsense probably null
R8408:Lrch3 UTSW 16 32,775,750 (GRCm39) missense probably damaging 1.00
R8686:Lrch3 UTSW 16 32,802,223 (GRCm39) missense possibly damaging 0.52
R8756:Lrch3 UTSW 16 32,808,810 (GRCm39) missense probably benign 0.33
R8947:Lrch3 UTSW 16 32,802,199 (GRCm39) missense possibly damaging 0.66
R9459:Lrch3 UTSW 16 32,799,775 (GRCm39) missense probably damaging 0.99
R9710:Lrch3 UTSW 16 32,796,108 (GRCm39) nonsense probably null
Z1176:Lrch3 UTSW 16 32,734,686 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCAAGAGCATAATCTCCTTAAC -3'
(R):5'- TGACTCAAGCTGCAGACCAG -3'

Sequencing Primer
(F):5'- GGAGTGTGTAAGTTCCAGTG -3'
(R):5'- GGCTATCCCAGAATTCACTATGTAGC -3'
Posted On 2015-10-21