Incidental Mutation 'R4723:Tiam2'
ID 354631
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene Name T cell lymphoma invasion and metastasis 2
Synonyms STEF, 3000002F19Rik
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 3376675-3569672 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3500592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 891 (Y891C)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405]
AlphaFold Q6ZPF3
Predicted Effect probably benign
Transcript: ENSMUST00000072156
AA Change: Y891C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: Y891C

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169838
AA Change: Y891C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: Y891C

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227405
Meta Mutation Damage Score 0.0960 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3,465,303 (GRCm39) missense probably benign 0.21
IGL01320:Tiam2 APN 17 3,556,020 (GRCm39) missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3,477,477 (GRCm39) missense probably benign 0.08
IGL01575:Tiam2 APN 17 3,504,591 (GRCm39) missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3,477,565 (GRCm39) missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3,471,756 (GRCm39) missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3,489,971 (GRCm39) splice site probably benign
IGL03102:Tiam2 APN 17 3,559,823 (GRCm39) missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3,488,983 (GRCm39) missense probably damaging 0.97
Feste_burg UTSW 17 3,464,897 (GRCm39) frame shift probably null
R0257:Tiam2 UTSW 17 3,501,088 (GRCm39) missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3,553,193 (GRCm39) missense probably benign 0.01
R0528:Tiam2 UTSW 17 3,561,346 (GRCm39) missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3,471,921 (GRCm39) missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3,479,229 (GRCm39) missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3,488,956 (GRCm39) nonsense probably null
R0645:Tiam2 UTSW 17 3,564,973 (GRCm39) missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3,563,108 (GRCm39) unclassified probably benign
R1139:Tiam2 UTSW 17 3,527,542 (GRCm39) missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3,464,472 (GRCm39) missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3,464,472 (GRCm39) missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3,566,978 (GRCm39) missense probably benign 0.00
R1671:Tiam2 UTSW 17 3,557,109 (GRCm39) missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3,568,698 (GRCm39) missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3,566,278 (GRCm39) missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3,487,510 (GRCm39) missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3,465,410 (GRCm39) missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3,465,410 (GRCm39) missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3,565,000 (GRCm39) missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3,565,000 (GRCm39) missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3,465,401 (GRCm39) nonsense probably null
R2211:Tiam2 UTSW 17 3,465,193 (GRCm39) nonsense probably null
R2217:Tiam2 UTSW 17 3,465,389 (GRCm39) missense probably benign 0.34
R2278:Tiam2 UTSW 17 3,477,495 (GRCm39) missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3,527,536 (GRCm39) missense probably benign 0.14
R2516:Tiam2 UTSW 17 3,503,657 (GRCm39) missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3,568,525 (GRCm39) missense probably benign
R3086:Tiam2 UTSW 17 3,471,857 (GRCm39) missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3,489,977 (GRCm39) missense probably benign 0.01
R3686:Tiam2 UTSW 17 3,471,959 (GRCm39) missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3,464,388 (GRCm39) missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3,464,388 (GRCm39) missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3,557,976 (GRCm39) splice site probably benign
R3829:Tiam2 UTSW 17 3,557,976 (GRCm39) splice site probably benign
R3844:Tiam2 UTSW 17 3,471,926 (GRCm39) missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3,479,106 (GRCm39) missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3,479,255 (GRCm39) missense probably benign 0.00
R4296:Tiam2 UTSW 17 3,501,120 (GRCm39) missense probably benign
R4357:Tiam2 UTSW 17 3,501,128 (GRCm39) missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3,464,958 (GRCm39) missense probably benign 0.01
R4369:Tiam2 UTSW 17 3,464,242 (GRCm39) start gained probably benign
R4524:Tiam2 UTSW 17 3,564,986 (GRCm39) missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3,568,617 (GRCm39) missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3,504,443 (GRCm39) missense probably damaging 1.00
R4979:Tiam2 UTSW 17 3,555,985 (GRCm39) missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3,488,996 (GRCm39) missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3,479,271 (GRCm39) missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3,465,231 (GRCm39) missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3,498,764 (GRCm39) missense probably benign 0.00
R5879:Tiam2 UTSW 17 3,487,540 (GRCm39) missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3,488,915 (GRCm39) missense probably benign 0.24
R5974:Tiam2 UTSW 17 3,465,084 (GRCm39) missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3,464,396 (GRCm39) missense probably benign 0.06
R6222:Tiam2 UTSW 17 3,503,613 (GRCm39) missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3,559,831 (GRCm39) missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3,464,897 (GRCm39) frame shift probably null
R6356:Tiam2 UTSW 17 3,464,897 (GRCm39) frame shift probably null
R6454:Tiam2 UTSW 17 3,488,938 (GRCm39) missense probably benign 0.00
R6497:Tiam2 UTSW 17 3,557,102 (GRCm39) missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3,464,897 (GRCm39) frame shift probably null
R6580:Tiam2 UTSW 17 3,464,897 (GRCm39) frame shift probably null
R6581:Tiam2 UTSW 17 3,464,897 (GRCm39) frame shift probably null
R6582:Tiam2 UTSW 17 3,464,897 (GRCm39) frame shift probably null
R6648:Tiam2 UTSW 17 3,557,148 (GRCm39) missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3,568,518 (GRCm39) missense probably benign 0.01
R6758:Tiam2 UTSW 17 3,568,678 (GRCm39) missense probably benign 0.01
R6836:Tiam2 UTSW 17 3,464,655 (GRCm39) missense probably benign 0.17
R6924:Tiam2 UTSW 17 3,558,070 (GRCm39) missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3,568,934 (GRCm39) missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3,498,758 (GRCm39) missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3,498,660 (GRCm39) missense probably benign 0.36
R7214:Tiam2 UTSW 17 3,568,687 (GRCm39) missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3,503,644 (GRCm39) missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3,553,283 (GRCm39) missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3,464,388 (GRCm39) missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3,532,880 (GRCm39) start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3,568,431 (GRCm39) missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3,471,591 (GRCm39) missense probably benign 0.01
R7805:Tiam2 UTSW 17 3,559,685 (GRCm39) missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3,487,522 (GRCm39) missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3,568,399 (GRCm39) missense possibly damaging 0.82
R7989:Tiam2 UTSW 17 3,568,524 (GRCm39) nonsense probably null
R8011:Tiam2 UTSW 17 3,498,671 (GRCm39) missense possibly damaging 0.92
R8221:Tiam2 UTSW 17 3,568,860 (GRCm39) missense probably damaging 0.99
R8260:Tiam2 UTSW 17 3,568,594 (GRCm39) missense possibly damaging 0.94
R8292:Tiam2 UTSW 17 3,557,142 (GRCm39) missense probably benign 0.01
R8406:Tiam2 UTSW 17 3,558,065 (GRCm39) missense possibly damaging 0.94
R8424:Tiam2 UTSW 17 3,566,317 (GRCm39) missense probably damaging 1.00
R8424:Tiam2 UTSW 17 3,566,316 (GRCm39) missense probably damaging 1.00
R8430:Tiam2 UTSW 17 3,568,537 (GRCm39) missense probably benign 0.05
R8530:Tiam2 UTSW 17 3,501,087 (GRCm39) missense probably benign 0.03
R8692:Tiam2 UTSW 17 3,479,082 (GRCm39) missense probably damaging 1.00
R8902:Tiam2 UTSW 17 3,527,471 (GRCm39) missense probably benign 0.00
R9067:Tiam2 UTSW 17 3,561,407 (GRCm39) missense probably damaging 1.00
R9080:Tiam2 UTSW 17 3,464,519 (GRCm39) missense probably benign
R9090:Tiam2 UTSW 17 3,465,011 (GRCm39) missense probably damaging 1.00
R9211:Tiam2 UTSW 17 3,498,729 (GRCm39) missense possibly damaging 0.94
R9271:Tiam2 UTSW 17 3,465,011 (GRCm39) missense probably damaging 1.00
R9347:Tiam2 UTSW 17 3,471,923 (GRCm39) missense probably benign 0.37
R9353:Tiam2 UTSW 17 3,558,074 (GRCm39) nonsense probably null
R9407:Tiam2 UTSW 17 3,553,298 (GRCm39) missense probably damaging 1.00
R9460:Tiam2 UTSW 17 3,487,585 (GRCm39) missense probably damaging 1.00
R9550:Tiam2 UTSW 17 3,559,706 (GRCm39) missense probably damaging 1.00
R9748:Tiam2 UTSW 17 3,561,440 (GRCm39) missense probably benign 0.20
X0027:Tiam2 UTSW 17 3,464,275 (GRCm39) start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3,500,629 (GRCm39) splice site probably null
X0065:Tiam2 UTSW 17 3,555,983 (GRCm39) missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3,465,294 (GRCm39) missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3,556,051 (GRCm39) missense probably null 1.00
Z1177:Tiam2 UTSW 17 3,477,538 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACGAATTTTGACCCTTGC -3'
(R):5'- CCAAATTAAGAGGCCATGCG -3'

Sequencing Primer
(F):5'- ACAACGAATTTTGACCCTTGCTTTTC -3'
(R):5'- GTGGCGCACACTTGTATTC -3'
Posted On 2015-10-21