Incidental Mutation 'R4723:Arid1b'
ID 354632
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene Name AT-rich interaction domain 1B
Synonyms 9330189K18Rik, B230217J03Rik
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.783) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 5044607-5397931 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 5387565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1673 (I1673L)
Ref Sequence ENSEMBL: ENSMUSP00000156119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
AlphaFold E9Q4N7
Predicted Effect probably benign
Transcript: ENSMUST00000092723
AA Change: I1620L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: I1620L

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115797
AA Change: I1621L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: I1621L

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115799
AA Change: I1139L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: I1139L

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232180
AA Change: I1673L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5,387,385 (GRCm39) missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5,371,559 (GRCm39) missense probably damaging 1.00
IGL00886:Arid1b APN 17 5,177,254 (GRCm39) missense probably damaging 0.99
IGL01161:Arid1b APN 17 5,392,674 (GRCm39) missense probably damaging 1.00
IGL01391:Arid1b APN 17 5,369,133 (GRCm39) splice site probably benign
IGL01456:Arid1b APN 17 5,341,510 (GRCm39) missense probably damaging 1.00
IGL02152:Arid1b APN 17 5,364,243 (GRCm39) missense probably damaging 1.00
IGL02288:Arid1b APN 17 5,314,315 (GRCm39) missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5,393,286 (GRCm39) missense probably damaging 1.00
IGL02858:Arid1b APN 17 5,392,166 (GRCm39) missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5,392,428 (GRCm39) missense probably damaging 1.00
IGL02989:Arid1b APN 17 5,385,322 (GRCm39) missense probably damaging 1.00
FR4449:Arid1b UTSW 17 5,045,864 (GRCm39) small insertion probably benign
PIT4142001:Arid1b UTSW 17 5,389,518 (GRCm39) missense probably damaging 1.00
R0048:Arid1b UTSW 17 5,364,309 (GRCm39) critical splice donor site probably null
R0124:Arid1b UTSW 17 5,389,605 (GRCm39) missense probably damaging 1.00
R0153:Arid1b UTSW 17 5,393,207 (GRCm39) missense probably damaging 1.00
R0465:Arid1b UTSW 17 5,046,535 (GRCm39) missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5,392,453 (GRCm39) missense probably damaging 1.00
R1172:Arid1b UTSW 17 5,389,575 (GRCm39) missense probably damaging 1.00
R1468:Arid1b UTSW 17 5,293,197 (GRCm39) missense probably damaging 0.99
R1468:Arid1b UTSW 17 5,293,197 (GRCm39) missense probably damaging 0.99
R1616:Arid1b UTSW 17 5,389,569 (GRCm39) missense probably damaging 1.00
R1754:Arid1b UTSW 17 5,329,476 (GRCm39) critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5,392,088 (GRCm39) missense probably damaging 0.97
R1812:Arid1b UTSW 17 5,387,304 (GRCm39) missense probably benign 0.10
R1911:Arid1b UTSW 17 5,393,241 (GRCm39) missense probably damaging 1.00
R3874:Arid1b UTSW 17 5,386,790 (GRCm39) splice site probably null
R3913:Arid1b UTSW 17 5,392,532 (GRCm39) missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5,392,928 (GRCm39) missense probably benign 0.25
R3922:Arid1b UTSW 17 5,393,316 (GRCm39) missense probably damaging 0.97
R4119:Arid1b UTSW 17 5,046,069 (GRCm39) unclassified probably benign
R4290:Arid1b UTSW 17 5,090,938 (GRCm39) missense probably damaging 1.00
R4291:Arid1b UTSW 17 5,090,938 (GRCm39) missense probably damaging 1.00
R4352:Arid1b UTSW 17 5,147,859 (GRCm39) missense possibly damaging 0.93
R4386:Arid1b UTSW 17 5,045,247 (GRCm39) unclassified probably benign
R4458:Arid1b UTSW 17 5,293,191 (GRCm39) missense probably damaging 0.99
R4524:Arid1b UTSW 17 5,147,895 (GRCm39) missense possibly damaging 0.93
R4622:Arid1b UTSW 17 5,045,325 (GRCm39) unclassified probably benign
R4782:Arid1b UTSW 17 5,389,496 (GRCm39) missense probably damaging 1.00
R4799:Arid1b UTSW 17 5,389,496 (GRCm39) missense probably damaging 1.00
R4910:Arid1b UTSW 17 5,392,478 (GRCm39) missense probably damaging 1.00
R4946:Arid1b UTSW 17 5,393,118 (GRCm39) missense probably damaging 0.99
R5083:Arid1b UTSW 17 5,364,293 (GRCm39) missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5,393,316 (GRCm39) missense probably damaging 0.97
R5347:Arid1b UTSW 17 5,341,332 (GRCm39) nonsense probably null
R5553:Arid1b UTSW 17 5,364,152 (GRCm39) missense probably damaging 1.00
R5713:Arid1b UTSW 17 5,387,091 (GRCm39) missense probably damaging 1.00
R5820:Arid1b UTSW 17 5,046,529 (GRCm39) missense possibly damaging 0.96
R5992:Arid1b UTSW 17 5,045,231 (GRCm39) unclassified probably benign
R6038:Arid1b UTSW 17 5,386,957 (GRCm39) missense probably benign 0.07
R6038:Arid1b UTSW 17 5,386,957 (GRCm39) missense probably benign 0.07
R6153:Arid1b UTSW 17 5,293,107 (GRCm39) missense probably damaging 1.00
R6222:Arid1b UTSW 17 5,377,922 (GRCm39) critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5,329,636 (GRCm39) missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5,392,274 (GRCm39) missense probably damaging 1.00
R6329:Arid1b UTSW 17 5,387,538 (GRCm39) nonsense probably null
R6368:Arid1b UTSW 17 5,382,808 (GRCm39) missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5,377,953 (GRCm39) missense probably damaging 1.00
R6861:Arid1b UTSW 17 5,377,961 (GRCm39) missense possibly damaging 0.93
R7008:Arid1b UTSW 17 5,341,254 (GRCm39) missense probably damaging 1.00
R7270:Arid1b UTSW 17 5,046,318 (GRCm39) missense unknown
R7514:Arid1b UTSW 17 5,391,989 (GRCm39) missense probably benign 0.28
R7519:Arid1b UTSW 17 5,046,128 (GRCm39) small insertion probably benign
R7519:Arid1b UTSW 17 5,046,119 (GRCm39) small insertion probably benign
R7521:Arid1b UTSW 17 5,392,865 (GRCm39) missense probably benign 0.06
R7521:Arid1b UTSW 17 5,046,119 (GRCm39) small insertion probably benign
R7521:Arid1b UTSW 17 5,046,135 (GRCm39) small insertion probably benign
R7616:Arid1b UTSW 17 5,045,661 (GRCm39) missense unknown
R7654:Arid1b UTSW 17 5,341,360 (GRCm39) missense possibly damaging 0.46
R7711:Arid1b UTSW 17 5,387,095 (GRCm39) missense probably benign 0.28
R7828:Arid1b UTSW 17 5,147,943 (GRCm39) missense probably damaging 1.00
R7864:Arid1b UTSW 17 5,392,530 (GRCm39) missense probably damaging 1.00
R7998:Arid1b UTSW 17 5,377,959 (GRCm39) missense probably damaging 1.00
R8105:Arid1b UTSW 17 5,341,518 (GRCm39) missense possibly damaging 0.81
R8260:Arid1b UTSW 17 5,382,788 (GRCm39) missense probably benign 0.03
R8374:Arid1b UTSW 17 5,392,919 (GRCm39) missense possibly damaging 0.95
R8779:Arid1b UTSW 17 5,391,809 (GRCm39) missense probably benign 0.03
R8801:Arid1b UTSW 17 5,387,103 (GRCm39) missense probably benign 0.05
R8894:Arid1b UTSW 17 5,377,668 (GRCm39) missense probably damaging 0.98
R8982:Arid1b UTSW 17 5,293,316 (GRCm39) missense probably damaging 0.98
R9034:Arid1b UTSW 17 5,387,180 (GRCm39) missense probably benign 0.01
R9272:Arid1b UTSW 17 5,386,879 (GRCm39) missense possibly damaging 0.80
R9300:Arid1b UTSW 17 5,293,274 (GRCm39) missense probably damaging 1.00
R9332:Arid1b UTSW 17 5,045,584 (GRCm39) missense unknown
R9481:Arid1b UTSW 17 5,369,007 (GRCm39) missense probably damaging 1.00
R9493:Arid1b UTSW 17 5,046,423 (GRCm39) missense unknown
R9512:Arid1b UTSW 17 5,391,864 (GRCm39) missense probably benign 0.00
R9548:Arid1b UTSW 17 5,385,262 (GRCm39) missense probably damaging 1.00
RF007:Arid1b UTSW 17 5,045,869 (GRCm39) small insertion probably benign
RF008:Arid1b UTSW 17 5,045,870 (GRCm39) small insertion probably benign
RF008:Arid1b UTSW 17 5,045,869 (GRCm39) small insertion probably benign
RF025:Arid1b UTSW 17 5,045,871 (GRCm39) small insertion probably benign
RF025:Arid1b UTSW 17 5,045,863 (GRCm39) small insertion probably benign
RF028:Arid1b UTSW 17 5,045,873 (GRCm39) small insertion probably benign
RF032:Arid1b UTSW 17 5,045,863 (GRCm39) small insertion probably benign
RF033:Arid1b UTSW 17 5,045,860 (GRCm39) small insertion probably benign
RF041:Arid1b UTSW 17 5,045,870 (GRCm39) small insertion probably benign
RF045:Arid1b UTSW 17 5,045,858 (GRCm39) small insertion probably benign
RF046:Arid1b UTSW 17 5,045,865 (GRCm39) small insertion probably benign
RF058:Arid1b UTSW 17 5,045,858 (GRCm39) small insertion probably benign
X0023:Arid1b UTSW 17 5,392,668 (GRCm39) missense probably benign 0.39
X0027:Arid1b UTSW 17 5,392,647 (GRCm39) nonsense probably null
Z1177:Arid1b UTSW 17 5,046,603 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAGCAAGTCTCCCTTCCTGC -3'
(R):5'- TTGCACCTCAGAGGATCATTTAG -3'

Sequencing Primer
(F):5'- TTCCTGCCCACCATGAAGATG -3'
(R):5'- CACCTCAGAGGATCATTTAGATTCAG -3'
Posted On 2015-10-21