Incidental Mutation 'R4724:Lepr'
ID354661
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission 041988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4724 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 101765365 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 447 (W447*)
Ref Sequence ENSEMBL: ENSMUSP00000102534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
Predicted Effect probably null
Transcript: ENSMUST00000037552
AA Change: W447*
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: W447*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102777
AA Change: W447*
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: W447*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106921
AA Change: W447*
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: W447*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128948
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C G 3: 90,053,541 Q34E probably damaging Het
4933434E20Rik A T 3: 90,053,542 Q34L probably damaging Het
4933434E20Rik G T 3: 90,053,583 V48F probably damaging Het
8430408G22Rik T A 6: 116,652,135 C146* probably null Het
Abra T C 15: 41,865,906 D366G probably damaging Het
Acvr2a T C 2: 48,870,435 S68P probably damaging Het
Adam28 T A 14: 68,626,877 R492S probably damaging Het
Adamts1 T A 16: 85,802,505 E69V probably benign Het
Adgra1 A T 7: 139,875,589 M378L probably benign Het
Adgra2 T A 8: 27,098,822 N101K possibly damaging Het
Adhfe1 T A 1: 9,576,250 F449L probably damaging Het
Akap6 T A 12: 52,795,885 S5R possibly damaging Het
Akap9 G A 5: 4,055,339 R2883Q probably benign Het
Ank3 T A 10: 69,706,858 I16N probably benign Het
Api5 A T 2: 94,423,471 F296I possibly damaging Het
Ceacam14 G T 7: 17,814,050 probably null Het
Cep295 C T 9: 15,330,832 G1768S probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cp C A 3: 19,972,647 T413K probably benign Het
Ctdsp2 T G 10: 126,993,069 V104G probably damaging Het
Ctrc T A 4: 141,846,296 probably null Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dctn1 T A 6: 83,189,938 M257K possibly damaging Het
Dlgap5 C T 14: 47,401,520 probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Exoc8 A G 8: 124,897,250 V126A probably benign Het
Fam185a T A 5: 21,455,787 S267T probably damaging Het
Fhod1 T C 8: 105,337,861 probably benign Het
Fn1 T C 1: 71,648,148 probably null Het
Gadl1 A T 9: 115,954,617 T214S possibly damaging Het
Gem G T 4: 11,706,074 R54L probably damaging Het
Ghr A G 15: 3,325,940 V287A probably benign Het
Gm3642 G A 14: 6,833,344 T215I probably benign Het
Grip1 T A 10: 120,038,683 I732K probably benign Het
Gtpbp2 A T 17: 46,167,221 probably null Het
Heatr6 C T 11: 83,779,548 R976* probably null Het
Hipk2 T A 6: 38,698,392 T1084S probably benign Het
Hmcn1 T C 1: 150,694,833 probably null Het
Hspg2 T A 4: 137,522,127 M1328K probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ighv1-64 A G 12: 115,507,846 V17A probably benign Het
Iqgap2 G T 13: 95,635,497 N1391K possibly damaging Het
Irf7 A T 7: 141,264,735 L148Q possibly damaging Het
Kat6b G A 14: 21,660,962 R768K probably benign Het
Letmd1 A G 15: 100,469,738 Y59C probably damaging Het
Lingo4 A T 3: 94,402,876 K374* probably null Het
Loxl4 G T 19: 42,608,346 D62E probably benign Het
Lrfn2 A G 17: 49,070,434 D181G probably damaging Het
Lrrc71 A T 3: 87,739,174 F526L probably damaging Het
Ltbp1 A T 17: 75,313,008 M711L probably damaging Het
Mcm7 A T 5: 138,169,125 D78E probably damaging Het
Mdh1 T C 11: 21,562,957 N136D probably damaging Het
Meltf T A 16: 31,892,505 N515K probably benign Het
Mis18bp1 T A 12: 65,158,739 T220S probably benign Het
Mtss1 C T 15: 59,081,518 V4M probably damaging Het
Nacc2 A T 2: 26,090,173 F84I probably damaging Het
Nedd9 A G 13: 41,316,597 V360A possibly damaging Het
Nek11 T A 9: 105,392,970 I18F possibly damaging Het
Nkd2 C T 13: 73,847,005 V13M probably damaging Het
Nkx6-3 A G 8: 23,156,269 I152V probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1 A T 11: 73,395,155 I289N probably damaging Het
Olfr1352 A G 10: 78,984,522 H244R probably damaging Het
Olfr1434 T C 19: 12,283,096 L16P probably damaging Het
Olfr215 T C 6: 116,582,937 N3S probably damaging Het
Olfr494 T A 7: 108,367,998 F169L probably benign Het
Olfr66 A G 7: 103,881,649 V198A probably benign Het
Oprm1 A T 10: 6,758,656 R16* probably null Het
Ostf1 G A 19: 18,593,867 P62L probably damaging Het
Pcdha2 A T 18: 36,940,515 T400S possibly damaging Het
Pcdha5 A T 18: 36,961,496 T353S possibly damaging Het
Pelo A G 13: 115,088,735 F318S probably damaging Het
Polr2f T C 15: 79,146,069 V36A probably benign Het
Ppan G A 9: 20,888,510 R41H probably benign Het
Ppp1r21 C T 17: 88,555,591 R253* probably null Het
Prf1 T A 10: 61,303,708 W482R probably damaging Het
Ralgapa2 T C 2: 146,345,533 T1397A possibly damaging Het
Rev3l T A 10: 39,846,806 Y2598* probably null Het
Scaf11 G T 15: 96,414,848 D1437E probably benign Het
Sec23a C T 12: 58,978,506 G510R probably damaging Het
Sel1l2 A G 2: 140,240,927 M597T probably damaging Het
Slc11a2 A T 15: 100,406,338 S160T possibly damaging Het
Slc18a1 A T 8: 69,073,649 L129* probably null Het
Smg8 A C 11: 87,086,221 L178R probably benign Het
Sp4 T C 12: 118,261,809 T607A probably benign Het
Ssbp2 A G 13: 91,688,814 D266G possibly damaging Het
Sstr3 A T 15: 78,539,697 Y283* probably null Het
Stk32b C T 5: 37,454,934 probably null Het
Svep1 T C 4: 58,070,752 T2345A possibly damaging Het
Synpo2 A G 3: 123,114,291 S459P probably damaging Het
Sytl2 A G 7: 90,348,792 M1V probably null Het
Tas2r102 T A 6: 132,762,557 W143R probably damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tlr2 A T 3: 83,838,185 I197N probably damaging Het
Tmem101 A G 11: 102,153,443 I206T probably benign Het
Tmem108 A G 9: 103,499,489 S254P possibly damaging Het
Tmem198b T C 10: 128,801,481 Q263R probably damaging Het
Vangl1 T C 3: 102,184,554 D72G probably damaging Het
Vmn1r4 T A 6: 56,957,364 D284E probably benign Het
Vmn2r31 G A 7: 7,384,758 L605F possibly damaging Het
Zfand4 T C 6: 116,273,819 V70A probably damaging Het
Zfp54 A G 17: 21,433,403 E53G probably damaging Het
Zfp541 A T 7: 16,081,687 I805F probably damaging Het
Zfp976 T C 7: 42,613,033 H460R possibly damaging Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCATGGACTGCGTTAGAGTCC -3'
(R):5'- CTTGCATGCCACTCAAAAGC -3'

Sequencing Primer
(F):5'- GCGTTAGAGTCCTACTAAAGATGCC -3'
(R):5'- GCCTTGGGTGTAAATTTTTCAAAG -3'
Posted On2015-10-21