Incidental Mutation 'R4724:Adgra2'
ID354686
Institutional Source Beutler Lab
Gene Symbol Adgra2
Ensembl Gene ENSMUSG00000031486
Gene Nameadhesion G protein-coupled receptor A2
SynonymsTem5, 8430414O08Rik, Gpr124, 9530074E10Rik
MMRRC Submission 041988-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4724 (G1)
Quality Score221
Status Not validated
Chromosome8
Chromosomal Location27085583-27123436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27098822 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 101 (N101K)
Ref Sequence ENSEMBL: ENSMUSP00000136277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000178514]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033876
AA Change: N101K

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486
AA Change: N101K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 1.06e2 SMART
LRR_TYP 107 130 2.71e-2 SMART
LRR_TYP 131 154 1.28e-3 SMART
LRR 155 178 7.38e1 SMART
LRRCT 190 240 4.63e-6 SMART
IG 253 346 3.49e-3 SMART
low complexity region 629 639 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Pfam:GPS 709 750 1.1e-7 PFAM
Pfam:7tm_2 770 990 5.3e-13 PFAM
transmembrane domain 1016 1038 N/A INTRINSIC
transmembrane domain 1045 1064 N/A INTRINSIC
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1110 1129 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178514
AA Change: N101K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486
AA Change: N101K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 4.4e-1 SMART
LRR_TYP 107 130 1.1e-4 SMART
LRR_TYP 131 154 5.3e-6 SMART
LRR 155 178 3.1e-1 SMART
LRRCT 190 240 2.2e-8 SMART
IG 253 346 1.4e-5 SMART
HormR 349 426 1.8e-4 SMART
Pfam:7tm_2 554 775 3.2e-11 PFAM
transmembrane domain 801 823 N/A INTRINSIC
transmembrane domain 830 849 N/A INTRINSIC
low complexity region 860 880 N/A INTRINSIC
low complexity region 895 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display fetal or perinatal lethality with CNS hemorrhage and angiogenic arrest in the CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C G 3: 90,053,541 Q34E probably damaging Het
4933434E20Rik A T 3: 90,053,542 Q34L probably damaging Het
4933434E20Rik G T 3: 90,053,583 V48F probably damaging Het
8430408G22Rik T A 6: 116,652,135 C146* probably null Het
Abra T C 15: 41,865,906 D366G probably damaging Het
Acvr2a T C 2: 48,870,435 S68P probably damaging Het
Adam28 T A 14: 68,626,877 R492S probably damaging Het
Adamts1 T A 16: 85,802,505 E69V probably benign Het
Adgra1 A T 7: 139,875,589 M378L probably benign Het
Adhfe1 T A 1: 9,576,250 F449L probably damaging Het
Akap6 T A 12: 52,795,885 S5R possibly damaging Het
Akap9 G A 5: 4,055,339 R2883Q probably benign Het
Ank3 T A 10: 69,706,858 I16N probably benign Het
Api5 A T 2: 94,423,471 F296I possibly damaging Het
Ceacam14 G T 7: 17,814,050 probably null Het
Cep295 C T 9: 15,330,832 G1768S probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cp C A 3: 19,972,647 T413K probably benign Het
Ctdsp2 T G 10: 126,993,069 V104G probably damaging Het
Ctrc T A 4: 141,846,296 probably null Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dctn1 T A 6: 83,189,938 M257K possibly damaging Het
Dlgap5 C T 14: 47,401,520 probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Exoc8 A G 8: 124,897,250 V126A probably benign Het
Fam185a T A 5: 21,455,787 S267T probably damaging Het
Fhod1 T C 8: 105,337,861 probably benign Het
Fn1 T C 1: 71,648,148 probably null Het
Gadl1 A T 9: 115,954,617 T214S possibly damaging Het
Gem G T 4: 11,706,074 R54L probably damaging Het
Ghr A G 15: 3,325,940 V287A probably benign Het
Gm3642 G A 14: 6,833,344 T215I probably benign Het
Grip1 T A 10: 120,038,683 I732K probably benign Het
Gtpbp2 A T 17: 46,167,221 probably null Het
Heatr6 C T 11: 83,779,548 R976* probably null Het
Hipk2 T A 6: 38,698,392 T1084S probably benign Het
Hmcn1 T C 1: 150,694,833 probably null Het
Hspg2 T A 4: 137,522,127 M1328K probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ighv1-64 A G 12: 115,507,846 V17A probably benign Het
Iqgap2 G T 13: 95,635,497 N1391K possibly damaging Het
Irf7 A T 7: 141,264,735 L148Q possibly damaging Het
Kat6b G A 14: 21,660,962 R768K probably benign Het
Lepr G A 4: 101,765,365 W447* probably null Het
Letmd1 A G 15: 100,469,738 Y59C probably damaging Het
Lingo4 A T 3: 94,402,876 K374* probably null Het
Loxl4 G T 19: 42,608,346 D62E probably benign Het
Lrfn2 A G 17: 49,070,434 D181G probably damaging Het
Lrrc71 A T 3: 87,739,174 F526L probably damaging Het
Ltbp1 A T 17: 75,313,008 M711L probably damaging Het
Mcm7 A T 5: 138,169,125 D78E probably damaging Het
Mdh1 T C 11: 21,562,957 N136D probably damaging Het
Meltf T A 16: 31,892,505 N515K probably benign Het
Mis18bp1 T A 12: 65,158,739 T220S probably benign Het
Mtss1 C T 15: 59,081,518 V4M probably damaging Het
Nacc2 A T 2: 26,090,173 F84I probably damaging Het
Nedd9 A G 13: 41,316,597 V360A possibly damaging Het
Nek11 T A 9: 105,392,970 I18F possibly damaging Het
Nkd2 C T 13: 73,847,005 V13M probably damaging Het
Nkx6-3 A G 8: 23,156,269 I152V probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1 A T 11: 73,395,155 I289N probably damaging Het
Olfr1352 A G 10: 78,984,522 H244R probably damaging Het
Olfr1434 T C 19: 12,283,096 L16P probably damaging Het
Olfr215 T C 6: 116,582,937 N3S probably damaging Het
Olfr494 T A 7: 108,367,998 F169L probably benign Het
Olfr66 A G 7: 103,881,649 V198A probably benign Het
Oprm1 A T 10: 6,758,656 R16* probably null Het
Ostf1 G A 19: 18,593,867 P62L probably damaging Het
Pcdha2 A T 18: 36,940,515 T400S possibly damaging Het
Pcdha5 A T 18: 36,961,496 T353S possibly damaging Het
Pelo A G 13: 115,088,735 F318S probably damaging Het
Polr2f T C 15: 79,146,069 V36A probably benign Het
Ppan G A 9: 20,888,510 R41H probably benign Het
Ppp1r21 C T 17: 88,555,591 R253* probably null Het
Prf1 T A 10: 61,303,708 W482R probably damaging Het
Ralgapa2 T C 2: 146,345,533 T1397A possibly damaging Het
Rev3l T A 10: 39,846,806 Y2598* probably null Het
Scaf11 G T 15: 96,414,848 D1437E probably benign Het
Sec23a C T 12: 58,978,506 G510R probably damaging Het
Sel1l2 A G 2: 140,240,927 M597T probably damaging Het
Slc11a2 A T 15: 100,406,338 S160T possibly damaging Het
Slc18a1 A T 8: 69,073,649 L129* probably null Het
Smg8 A C 11: 87,086,221 L178R probably benign Het
Sp4 T C 12: 118,261,809 T607A probably benign Het
Ssbp2 A G 13: 91,688,814 D266G possibly damaging Het
Sstr3 A T 15: 78,539,697 Y283* probably null Het
Stk32b C T 5: 37,454,934 probably null Het
Svep1 T C 4: 58,070,752 T2345A possibly damaging Het
Synpo2 A G 3: 123,114,291 S459P probably damaging Het
Sytl2 A G 7: 90,348,792 M1V probably null Het
Tas2r102 T A 6: 132,762,557 W143R probably damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tlr2 A T 3: 83,838,185 I197N probably damaging Het
Tmem101 A G 11: 102,153,443 I206T probably benign Het
Tmem108 A G 9: 103,499,489 S254P possibly damaging Het
Tmem198b T C 10: 128,801,481 Q263R probably damaging Het
Vangl1 T C 3: 102,184,554 D72G probably damaging Het
Vmn1r4 T A 6: 56,957,364 D284E probably benign Het
Vmn2r31 G A 7: 7,384,758 L605F possibly damaging Het
Zfand4 T C 6: 116,273,819 V70A probably damaging Het
Zfp54 A G 17: 21,433,403 E53G probably damaging Het
Zfp541 A T 7: 16,081,687 I805F probably damaging Het
Zfp976 T C 7: 42,613,033 H460R possibly damaging Het
Other mutations in Adgra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Adgra2 APN 8 27085983 missense possibly damaging 0.81
IGL01599:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01627:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01629:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01632:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01968:Adgra2 APN 8 27121235 nonsense probably null
IGL02551:Adgra2 APN 8 27119222 missense probably benign
IGL02820:Adgra2 APN 8 27117507 missense probably damaging 1.00
R0735:Adgra2 UTSW 8 27117318 missense probably damaging 1.00
R0799:Adgra2 UTSW 8 27112495 missense probably damaging 1.00
R1183:Adgra2 UTSW 8 27114388 missense probably damaging 1.00
R1276:Adgra2 UTSW 8 27119824 missense probably damaging 0.99
R1389:Adgra2 UTSW 8 27111088 missense probably damaging 1.00
R1514:Adgra2 UTSW 8 27121278 nonsense probably null
R1601:Adgra2 UTSW 8 27110018 splice site probably null
R1760:Adgra2 UTSW 8 27119767 missense probably damaging 1.00
R1957:Adgra2 UTSW 8 27111168 missense possibly damaging 0.64
R1977:Adgra2 UTSW 8 27115761 missense possibly damaging 0.80
R2164:Adgra2 UTSW 8 27114204 nonsense probably null
R2181:Adgra2 UTSW 8 27121673 missense probably damaging 0.99
R4282:Adgra2 UTSW 8 27119244 missense possibly damaging 0.54
R4749:Adgra2 UTSW 8 27114197 missense probably damaging 1.00
R4809:Adgra2 UTSW 8 27110479 nonsense probably null
R5718:Adgra2 UTSW 8 27113486 critical splice donor site probably null
R6025:Adgra2 UTSW 8 27114463 missense probably damaging 0.99
R6078:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6079:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6138:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6140:Adgra2 UTSW 8 27115405 missense probably damaging 1.00
R6232:Adgra2 UTSW 8 27119165 missense probably benign 0.19
R6321:Adgra2 UTSW 8 27114162 missense probably benign 0.02
R6385:Adgra2 UTSW 8 27118850 missense probably damaging 1.00
R6676:Adgra2 UTSW 8 27111240 missense possibly damaging 0.50
R6724:Adgra2 UTSW 8 27114182 missense possibly damaging 0.93
R6862:Adgra2 UTSW 8 27113436 missense probably benign 0.01
R6862:Adgra2 UTSW 8 27113437 missense probably damaging 0.98
R7140:Adgra2 UTSW 8 27120901 critical splice donor site probably null
R7242:Adgra2 UTSW 8 27122027 missense probably damaging 1.00
X0050:Adgra2 UTSW 8 27113418 missense probably benign 0.32
X0062:Adgra2 UTSW 8 27120806 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGTAGGGTCCCTGCTTCATAAC -3'
(R):5'- GTACTGAAGAGCCCGTTTCTC -3'

Sequencing Primer
(F):5'- GCTTCATAACTCTAGGTGGCAAC -3'
(R):5'- AGCAGCTCTGTCCTCTAAACTAG -3'
Posted On2015-10-21