Incidental Mutation 'R4724:Rev3l'
ID354697
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene NameREV3 like, DNA directed polymerase zeta catalytic subunit
SynonymsSez4, Rev
MMRRC Submission 041988-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4724 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location39732118-39875211 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 39846806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 2598 (Y2598*)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
Predicted Effect probably null
Transcript: ENSMUST00000019986
AA Change: Y2598*
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: Y2598*

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably null
Transcript: ENSMUST00000139803
AA Change: Y724*
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841
AA Change: Y724*

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145333
Predicted Effect probably null
Transcript: ENSMUST00000164763
AA Change: Y2598*
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: Y2598*

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C G 3: 90,053,541 Q34E probably damaging Het
4933434E20Rik A T 3: 90,053,542 Q34L probably damaging Het
4933434E20Rik G T 3: 90,053,583 V48F probably damaging Het
8430408G22Rik T A 6: 116,652,135 C146* probably null Het
Abra T C 15: 41,865,906 D366G probably damaging Het
Acvr2a T C 2: 48,870,435 S68P probably damaging Het
Adam28 T A 14: 68,626,877 R492S probably damaging Het
Adamts1 T A 16: 85,802,505 E69V probably benign Het
Adgra1 A T 7: 139,875,589 M378L probably benign Het
Adgra2 T A 8: 27,098,822 N101K possibly damaging Het
Adhfe1 T A 1: 9,576,250 F449L probably damaging Het
Akap6 T A 12: 52,795,885 S5R possibly damaging Het
Akap9 G A 5: 4,055,339 R2883Q probably benign Het
Ank3 T A 10: 69,706,858 I16N probably benign Het
Api5 A T 2: 94,423,471 F296I possibly damaging Het
Ceacam14 G T 7: 17,814,050 probably null Het
Cep295 C T 9: 15,330,832 G1768S probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cp C A 3: 19,972,647 T413K probably benign Het
Ctdsp2 T G 10: 126,993,069 V104G probably damaging Het
Ctrc T A 4: 141,846,296 probably null Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dctn1 T A 6: 83,189,938 M257K possibly damaging Het
Dlgap5 C T 14: 47,401,520 probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Exoc8 A G 8: 124,897,250 V126A probably benign Het
Fam185a T A 5: 21,455,787 S267T probably damaging Het
Fhod1 T C 8: 105,337,861 probably benign Het
Fn1 T C 1: 71,648,148 probably null Het
Gadl1 A T 9: 115,954,617 T214S possibly damaging Het
Gem G T 4: 11,706,074 R54L probably damaging Het
Ghr A G 15: 3,325,940 V287A probably benign Het
Gm3642 G A 14: 6,833,344 T215I probably benign Het
Grip1 T A 10: 120,038,683 I732K probably benign Het
Gtpbp2 A T 17: 46,167,221 probably null Het
Heatr6 C T 11: 83,779,548 R976* probably null Het
Hipk2 T A 6: 38,698,392 T1084S probably benign Het
Hmcn1 T C 1: 150,694,833 probably null Het
Hspg2 T A 4: 137,522,127 M1328K probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ighv1-64 A G 12: 115,507,846 V17A probably benign Het
Iqgap2 G T 13: 95,635,497 N1391K possibly damaging Het
Irf7 A T 7: 141,264,735 L148Q possibly damaging Het
Kat6b G A 14: 21,660,962 R768K probably benign Het
Lepr G A 4: 101,765,365 W447* probably null Het
Letmd1 A G 15: 100,469,738 Y59C probably damaging Het
Lingo4 A T 3: 94,402,876 K374* probably null Het
Loxl4 G T 19: 42,608,346 D62E probably benign Het
Lrfn2 A G 17: 49,070,434 D181G probably damaging Het
Lrrc71 A T 3: 87,739,174 F526L probably damaging Het
Ltbp1 A T 17: 75,313,008 M711L probably damaging Het
Mcm7 A T 5: 138,169,125 D78E probably damaging Het
Mdh1 T C 11: 21,562,957 N136D probably damaging Het
Meltf T A 16: 31,892,505 N515K probably benign Het
Mis18bp1 T A 12: 65,158,739 T220S probably benign Het
Mtss1 C T 15: 59,081,518 V4M probably damaging Het
Nacc2 A T 2: 26,090,173 F84I probably damaging Het
Nedd9 A G 13: 41,316,597 V360A possibly damaging Het
Nek11 T A 9: 105,392,970 I18F possibly damaging Het
Nkd2 C T 13: 73,847,005 V13M probably damaging Het
Nkx6-3 A G 8: 23,156,269 I152V probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1 A T 11: 73,395,155 I289N probably damaging Het
Olfr1352 A G 10: 78,984,522 H244R probably damaging Het
Olfr1434 T C 19: 12,283,096 L16P probably damaging Het
Olfr215 T C 6: 116,582,937 N3S probably damaging Het
Olfr494 T A 7: 108,367,998 F169L probably benign Het
Olfr66 A G 7: 103,881,649 V198A probably benign Het
Oprm1 A T 10: 6,758,656 R16* probably null Het
Ostf1 G A 19: 18,593,867 P62L probably damaging Het
Pcdha2 A T 18: 36,940,515 T400S possibly damaging Het
Pcdha5 A T 18: 36,961,496 T353S possibly damaging Het
Pelo A G 13: 115,088,735 F318S probably damaging Het
Polr2f T C 15: 79,146,069 V36A probably benign Het
Ppan G A 9: 20,888,510 R41H probably benign Het
Ppp1r21 C T 17: 88,555,591 R253* probably null Het
Prf1 T A 10: 61,303,708 W482R probably damaging Het
Ralgapa2 T C 2: 146,345,533 T1397A possibly damaging Het
Scaf11 G T 15: 96,414,848 D1437E probably benign Het
Sec23a C T 12: 58,978,506 G510R probably damaging Het
Sel1l2 A G 2: 140,240,927 M597T probably damaging Het
Slc11a2 A T 15: 100,406,338 S160T possibly damaging Het
Slc18a1 A T 8: 69,073,649 L129* probably null Het
Smg8 A C 11: 87,086,221 L178R probably benign Het
Sp4 T C 12: 118,261,809 T607A probably benign Het
Ssbp2 A G 13: 91,688,814 D266G possibly damaging Het
Sstr3 A T 15: 78,539,697 Y283* probably null Het
Stk32b C T 5: 37,454,934 probably null Het
Svep1 T C 4: 58,070,752 T2345A possibly damaging Het
Synpo2 A G 3: 123,114,291 S459P probably damaging Het
Sytl2 A G 7: 90,348,792 M1V probably null Het
Tas2r102 T A 6: 132,762,557 W143R probably damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tlr2 A T 3: 83,838,185 I197N probably damaging Het
Tmem101 A G 11: 102,153,443 I206T probably benign Het
Tmem108 A G 9: 103,499,489 S254P possibly damaging Het
Tmem198b T C 10: 128,801,481 Q263R probably damaging Het
Vangl1 T C 3: 102,184,554 D72G probably damaging Het
Vmn1r4 T A 6: 56,957,364 D284E probably benign Het
Vmn2r31 G A 7: 7,384,758 L605F possibly damaging Het
Zfand4 T C 6: 116,273,819 V70A probably damaging Het
Zfp54 A G 17: 21,433,403 E53G probably damaging Het
Zfp541 A T 7: 16,081,687 I805F probably damaging Het
Zfp976 T C 7: 42,613,033 H460R possibly damaging Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39806969 missense probably benign
IGL00815:Rev3l APN 10 39859153 missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39864806 missense probably benign 0.39
IGL01765:Rev3l APN 10 39828265 missense probably benign 0.00
IGL01792:Rev3l APN 10 39823340 missense probably benign
IGL01950:Rev3l APN 10 39821157 missense probably damaging 1.00
IGL01963:Rev3l APN 10 39822737 missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39825099 missense probably damaging 1.00
IGL02288:Rev3l APN 10 39828216 missense probably benign
IGL02381:Rev3l APN 10 39821346 missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39821148 missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39822591 missense probably damaging 1.00
IGL02570:Rev3l APN 10 39848013 missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39821281 missense probably benign 0.10
IGL02654:Rev3l APN 10 39862734 missense probably damaging 1.00
IGL02720:Rev3l APN 10 39822395 nonsense probably null
IGL02746:Rev3l APN 10 39824589 missense probably damaging 0.99
IGL02829:Rev3l APN 10 39825240 missense probably damaging 1.00
IGL02961:Rev3l APN 10 39827945 missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39862747 nonsense probably null
IGL03029:Rev3l APN 10 39828486 missense probably benign 0.34
IGL03153:Rev3l APN 10 39806878 missense probably damaging 1.00
IGL03172:Rev3l APN 10 39824790 missense probably benign 0.10
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39874128 nonsense probably null
R0308:Rev3l UTSW 10 39824894 missense probably benign 0.09
R0355:Rev3l UTSW 10 39817286 missense probably damaging 1.00
R0513:Rev3l UTSW 10 39828143 missense probably benign 0.00
R0523:Rev3l UTSW 10 39848049 missense probably benign 0.02
R0559:Rev3l UTSW 10 39824487 missense probably damaging 1.00
R0761:Rev3l UTSW 10 39874195 missense probably benign 0.32
R1023:Rev3l UTSW 10 39832639 missense probably damaging 1.00
R1159:Rev3l UTSW 10 39851925 nonsense probably null
R1398:Rev3l UTSW 10 39821583 missense probably benign 0.05
R1478:Rev3l UTSW 10 39783333 critical splice donor site probably null
R1517:Rev3l UTSW 10 39838443 missense probably benign 0.34
R1527:Rev3l UTSW 10 39822822 missense probably damaging 1.00
R1635:Rev3l UTSW 10 39806662 missense probably damaging 0.98
R1695:Rev3l UTSW 10 39824615 nonsense probably null
R1695:Rev3l UTSW 10 39824616 missense probably damaging 0.97
R1782:Rev3l UTSW 10 39799885 missense probably benign
R1815:Rev3l UTSW 10 39822871 missense probably benign 0.41
R1818:Rev3l UTSW 10 39828424 missense probably benign 0.05
R2039:Rev3l UTSW 10 39824444 missense probably damaging 1.00
R2071:Rev3l UTSW 10 39824353 missense probably benign 0.17
R2101:Rev3l UTSW 10 39828096 missense probably benign 0.00
R2141:Rev3l UTSW 10 39848049 missense probably benign 0.02
R2883:Rev3l UTSW 10 39825156 missense probably damaging 1.00
R3787:Rev3l UTSW 10 39846210 missense probably damaging 0.97
R3910:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3912:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3913:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R4590:Rev3l UTSW 10 39806933 missense probably damaging 1.00
R4631:Rev3l UTSW 10 39828416 missense probably benign 0.44
R4633:Rev3l UTSW 10 39846186 missense probably damaging 1.00
R4707:Rev3l UTSW 10 39823397 missense probably damaging 0.99
R4810:Rev3l UTSW 10 39823725 missense probably benign 0.01
R4857:Rev3l UTSW 10 39838459 missense probably damaging 1.00
R4882:Rev3l UTSW 10 39821460 missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39823985 missense probably benign 0.30
R4970:Rev3l UTSW 10 39823330 missense probably benign 0.00
R4977:Rev3l UTSW 10 39823578 missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39823330 missense probably benign 0.00
R5261:Rev3l UTSW 10 39846729 missense probably damaging 1.00
R5419:Rev3l UTSW 10 39824931 missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39852075 critical splice donor site probably null
R5628:Rev3l UTSW 10 39822967 missense probably damaging 0.98
R5689:Rev3l UTSW 10 39794958 missense probably damaging 1.00
R5781:Rev3l UTSW 10 39823093 missense probably benign 0.00
R5829:Rev3l UTSW 10 39806906 missense probably damaging 0.97
R5984:Rev3l UTSW 10 39742689 intron probably benign
R5990:Rev3l UTSW 10 39823811 missense probably benign 0.17
R6054:Rev3l UTSW 10 39824150 missense probably benign 0.01
R6171:Rev3l UTSW 10 39862713 nonsense probably null
R6220:Rev3l UTSW 10 39822779 missense probably damaging 1.00
R6520:Rev3l UTSW 10 39822702 missense probably benign 0.06
R6798:Rev3l UTSW 10 39854763 missense probably damaging 1.00
R6811:Rev3l UTSW 10 39830921 nonsense probably null
R6812:Rev3l UTSW 10 39823548 missense probably benign
R6904:Rev3l UTSW 10 39821481 missense probably benign
R6905:Rev3l UTSW 10 39817327 missense probably benign 0.18
R6938:Rev3l UTSW 10 39862710 missense probably damaging 1.00
R7037:Rev3l UTSW 10 39851975 missense probably damaging 1.00
R7124:Rev3l UTSW 10 39822167 nonsense probably null
R7286:Rev3l UTSW 10 39823605 missense probably damaging 0.99
R7385:Rev3l UTSW 10 39823682 missense probably benign 0.01
R7575:Rev3l UTSW 10 39821445 missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39821538 missense probably damaging 1.00
R7597:Rev3l UTSW 10 39822884 missense probably damaging 1.00
X0022:Rev3l UTSW 10 39828607 critical splice donor site probably null
Z1088:Rev3l UTSW 10 39824318 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AAGTGACACCTGGAAATTTGAC -3'
(R):5'- AGCTGGGCTACATTCCAATTC -3'

Sequencing Primer
(F):5'- GTGACACCTGGAAATTTGACTAAAC -3'
(R):5'- GGGCTACATTCCAATTCATCTTATTC -3'
Posted On2015-10-21