Mutagenetix > Incidental Mutation

Incidental Mutation 'R4724:Rev3l'

354697

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

041988-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4724 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 39846806 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2598 (Y2598*)

Ref Sequence

ENSEMBL: ENSMUSP00000131519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000019986
AA Change: Y2598*

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: Y2598*

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably null
Transcript: ENSMUST00000139803
AA Change: Y724*

SMART Domains

Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841
AA Change: Y724*

Domain	Start	End	E-Value	Type
Blast:POLBc	1	369	1e-155	BLAST
POLBc	434	805	4.77e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145333

Predicted Effect

probably null
Transcript: ENSMUST00000164763
AA Change: Y2598*

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: Y2598*

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	C	G	3: 90,053,541	Q34E	probably damaging	Het
4933434E20Rik	A	T	3: 90,053,542	Q34L	probably damaging	Het
4933434E20Rik	G	T	3: 90,053,583	V48F	probably damaging	Het
8430408G22Rik	T	A	6: 116,652,135	C146*	probably null	Het
Abra	T	C	15: 41,865,906	D366G	probably damaging	Het
Acvr2a	T	C	2: 48,870,435	S68P	probably damaging	Het
Adam28	T	A	14: 68,626,877	R492S	probably damaging	Het
Adamts1	T	A	16: 85,802,505	E69V	probably benign	Het
Adgra1	A	T	7: 139,875,589	M378L	probably benign	Het
Adgra2	T	A	8: 27,098,822	N101K	possibly damaging	Het
Adhfe1	T	A	1: 9,576,250	F449L	probably damaging	Het
Akap6	T	A	12: 52,795,885	S5R	possibly damaging	Het
Akap9	G	A	5: 4,055,339	R2883Q	probably benign	Het
Ank3	T	A	10: 69,706,858	I16N	probably benign	Het
Api5	A	T	2: 94,423,471	F296I	possibly damaging	Het
Ceacam14	G	T	7: 17,814,050		probably null	Het
Cep295	C	T	9: 15,330,832	G1768S	probably damaging	Het
Cldn12	A	G	5: 5,508,385	F14S	probably damaging	Het
Cp	C	A	3: 19,972,647	T413K	probably benign	Het
Ctdsp2	T	G	10: 126,993,069	V104G	probably damaging	Het
Ctrc	T	A	4: 141,846,296		probably null	Het
Dbt	T	C	3: 116,533,296	I98T	probably damaging	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Dctn1	T	A	6: 83,189,938	M257K	possibly damaging	Het
Dlgap5	C	T	14: 47,401,520		probably null	Het
Drd3	G	T	16: 43,822,801	E467*	probably null	Het
Exoc8	A	G	8: 124,897,250	V126A	probably benign	Het
Fam185a	T	A	5: 21,455,787	S267T	probably damaging	Het
Fhod1	T	C	8: 105,337,861		probably benign	Het
Fn1	T	C	1: 71,648,148		probably null	Het
Gadl1	A	T	9: 115,954,617	T214S	possibly damaging	Het
Gem	G	T	4: 11,706,074	R54L	probably damaging	Het
Ghr	A	G	15: 3,325,940	V287A	probably benign	Het
Gm3642	G	A	14: 6,833,344	T215I	probably benign	Het
Grip1	T	A	10: 120,038,683	I732K	probably benign	Het
Gtpbp2	A	T	17: 46,167,221		probably null	Het
Heatr6	C	T	11: 83,779,548	R976*	probably null	Het
Hipk2	T	A	6: 38,698,392	T1084S	probably benign	Het
Hmcn1	T	C	1: 150,694,833		probably null	Het
Hspg2	T	A	4: 137,522,127	M1328K	probably damaging	Het
Ifna4	C	A	4: 88,842,282	T141K	probably benign	Het
Ighv1-64	A	G	12: 115,507,846	V17A	probably benign	Het
Iqgap2	G	T	13: 95,635,497	N1391K	possibly damaging	Het
Irf7	A	T	7: 141,264,735	L148Q	possibly damaging	Het
Kat6b	G	A	14: 21,660,962	R768K	probably benign	Het
Lepr	G	A	4: 101,765,365	W447*	probably null	Het
Letmd1	A	G	15: 100,469,738	Y59C	probably damaging	Het
Lingo4	A	T	3: 94,402,876	K374*	probably null	Het
Loxl4	G	T	19: 42,608,346	D62E	probably benign	Het
Lrfn2	A	G	17: 49,070,434	D181G	probably damaging	Het
Lrrc71	A	T	3: 87,739,174	F526L	probably damaging	Het
Ltbp1	A	T	17: 75,313,008	M711L	probably damaging	Het
Mcm7	A	T	5: 138,169,125	D78E	probably damaging	Het
Mdh1	T	C	11: 21,562,957	N136D	probably damaging	Het
Meltf	T	A	16: 31,892,505	N515K	probably benign	Het
Mis18bp1	T	A	12: 65,158,739	T220S	probably benign	Het
Mtss1	C	T	15: 59,081,518	V4M	probably damaging	Het
Nacc2	A	T	2: 26,090,173	F84I	probably damaging	Het
Nedd9	A	G	13: 41,316,597	V360A	possibly damaging	Het
Nek11	T	A	9: 105,392,970	I18F	possibly damaging	Het
Nkd2	C	T	13: 73,847,005	V13M	probably damaging	Het
Nkx6-3	A	G	8: 23,156,269	I152V	probably damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Olfr1	A	T	11: 73,395,155	I289N	probably damaging	Het
Olfr1352	A	G	10: 78,984,522	H244R	probably damaging	Het
Olfr1434	T	C	19: 12,283,096	L16P	probably damaging	Het
Olfr215	T	C	6: 116,582,937	N3S	probably damaging	Het
Olfr494	T	A	7: 108,367,998	F169L	probably benign	Het
Olfr66	A	G	7: 103,881,649	V198A	probably benign	Het
Oprm1	A	T	10: 6,758,656	R16*	probably null	Het
Ostf1	G	A	19: 18,593,867	P62L	probably damaging	Het
Pcdha2	A	T	18: 36,940,515	T400S	possibly damaging	Het
Pcdha5	A	T	18: 36,961,496	T353S	possibly damaging	Het
Pelo	A	G	13: 115,088,735	F318S	probably damaging	Het
Polr2f	T	C	15: 79,146,069	V36A	probably benign	Het
Ppan	G	A	9: 20,888,510	R41H	probably benign	Het
Ppp1r21	C	T	17: 88,555,591	R253*	probably null	Het
Prf1	T	A	10: 61,303,708	W482R	probably damaging	Het
Ralgapa2	T	C	2: 146,345,533	T1397A	possibly damaging	Het
Scaf11	G	T	15: 96,414,848	D1437E	probably benign	Het
Sec23a	C	T	12: 58,978,506	G510R	probably damaging	Het
Sel1l2	A	G	2: 140,240,927	M597T	probably damaging	Het
Slc11a2	A	T	15: 100,406,338	S160T	possibly damaging	Het
Slc18a1	A	T	8: 69,073,649	L129*	probably null	Het
Smg8	A	C	11: 87,086,221	L178R	probably benign	Het
Sp4	T	C	12: 118,261,809	T607A	probably benign	Het
Ssbp2	A	G	13: 91,688,814	D266G	possibly damaging	Het
Sstr3	A	T	15: 78,539,697	Y283*	probably null	Het
Stk32b	C	T	5: 37,454,934		probably null	Het
Svep1	T	C	4: 58,070,752	T2345A	possibly damaging	Het
Synpo2	A	G	3: 123,114,291	S459P	probably damaging	Het
Sytl2	A	G	7: 90,348,792	M1V	probably null	Het
Tas2r102	T	A	6: 132,762,557	W143R	probably damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tlr2	A	T	3: 83,838,185	I197N	probably damaging	Het
Tmem101	A	G	11: 102,153,443	I206T	probably benign	Het
Tmem108	A	G	9: 103,499,489	S254P	possibly damaging	Het
Tmem198b	T	C	10: 128,801,481	Q263R	probably damaging	Het
Vangl1	T	C	3: 102,184,554	D72G	probably damaging	Het
Vmn1r4	T	A	6: 56,957,364	D284E	probably benign	Het
Vmn2r31	G	A	7: 7,384,758	L605F	possibly damaging	Het
Zfand4	T	C	6: 116,273,819	V70A	probably damaging	Het
Zfp54	A	G	17: 21,433,403	E53G	probably damaging	Het
Zfp541	A	T	7: 16,081,687	I805F	probably damaging	Het
Zfp976	T	C	7: 42,613,033	H460R	possibly damaging	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0355:Rev3l	UTSW	10	39817286	missense	probably damaging	1.00
R0513:Rev3l	UTSW	10	39828143	missense	probably benign	0.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1398:Rev3l	UTSW	10	39821583	missense	probably benign	0.05
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1527:Rev3l	UTSW	10	39822822	missense	probably damaging	1.00
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3910:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6904:Rev3l	UTSW	10	39821481	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7037:Rev3l	UTSW	10	39851975	missense	probably damaging	1.00
R7124:Rev3l	UTSW	10	39822167	nonsense	probably null
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7991:Rev3l	UTSW	10	39863738	missense	possibly damaging	0.52
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
R8174:Rev3l	UTSW	10	39859115	missense	probably damaging	1.00
R8187:Rev3l	UTSW	10	39806697	missense	probably benign
R8299:Rev3l	UTSW	10	39821541	missense	probably benign	0.01
R8352:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8452:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8468:Rev3l	UTSW	10	39827991	missense	probably damaging	0.99
R8487:Rev3l	UTSW	10	39806848	missense	probably damaging	1.00
R8512:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R8554:Rev3l	UTSW	10	39806842	missense	probably benign	0.12
R8702:Rev3l	UTSW	10	39838469	nonsense	probably null
R8848:Rev3l	UTSW	10	39846709	missense	probably damaging	0.99
R8857:Rev3l	UTSW	10	39794969	nonsense	probably null
R8870:Rev3l	UTSW	10	39862790	missense	probably damaging	1.00
R9094:Rev3l	UTSW	10	39824813	missense	probably benign
R9175:Rev3l	UTSW	10	39854768	missense	possibly damaging	0.83
R9286:Rev3l	UTSW	10	39806951	missense	possibly damaging	0.54
R9299:Rev3l	UTSW	10	39848003	missense	probably damaging	1.00
R9307:Rev3l	UTSW	10	39817153	missense	probably benign	0.01
R9337:Rev3l	UTSW	10	39822854	missense	probably benign	0.40
R9342:Rev3l	UTSW	10	39821462	missense	probably benign
R9389:Rev3l	UTSW	10	39822971	missense	possibly damaging	0.47
R9395:Rev3l	UTSW	10	39859223	critical splice donor site	probably null
R9458:Rev3l	UTSW	10	39783251	missense	probably damaging	1.00
R9481:Rev3l	UTSW	10	39825037	missense	probably benign
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- AAGTGACACCTGGAAATTTGAC -3'
(R):5'- AGCTGGGCTACATTCCAATTC -3'

Sequencing Primer
(F):5'- GTGACACCTGGAAATTTGACTAAAC -3'
(R):5'- GGGCTACATTCCAATTCATCTTATTC -3'

Posted On

2015-10-21