Incidental Mutation 'R4724:Tmem198b'
ID354704
Institutional Source Beutler Lab
Gene Symbol Tmem198b
Ensembl Gene ENSMUSG00000047090
Gene Nametransmembrane protein 198b
Synonyms1110012D08Rik
MMRRC Submission 041988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4724 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128800036-128804370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128801481 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 263 (Q263R)
Ref Sequence ENSEMBL: ENSMUSP00000050451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026410] [ENSMUST00000026411] [ENSMUST00000051011] [ENSMUST00000139227] [ENSMUST00000217745] [ENSMUST00000218001] [ENSMUST00000218511] [ENSMUST00000219404] [ENSMUST00000219508]
Predicted Effect probably benign
Transcript: ENSMUST00000026410
SMART Domains Protein: ENSMUSP00000026410
Gene: ENSMUSG00000025354

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
DnaJ 443 500 1.3e-21 SMART
Pfam:Jiv90 532 621 5.9e-40 PFAM
low complexity region 690 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026411
SMART Domains Protein: ENSMUSP00000026411
Gene: ENSMUSG00000025355

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 26 81 6.7e-10 PFAM
ZnMc 101 258 5.13e-43 SMART
low complexity region 262 271 N/A INTRINSIC
HX 293 335 8.97e-8 SMART
HX 337 378 1e-5 SMART
HX 380 427 1.87e-5 SMART
HX 429 471 3.7e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000051011
AA Change: Q263R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050451
Gene: ENSMUSG00000047090
AA Change: Q263R

DomainStartEndE-ValueType
Pfam:DUF4203 43 240 2.4e-47 PFAM
low complexity region 257 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139227
SMART Domains Protein: ENSMUSP00000118082
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 96 4.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152966
SMART Domains Protein: ENSMUSP00000117574
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 241 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217745
Predicted Effect probably benign
Transcript: ENSMUST00000218001
Predicted Effect probably benign
Transcript: ENSMUST00000218511
Predicted Effect probably benign
Transcript: ENSMUST00000219404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219473
Predicted Effect probably benign
Transcript: ENSMUST00000219508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219535
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit impaired sensorimotor gating/attention during prepulse inhibition testing compared with wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C G 3: 90,053,541 Q34E probably damaging Het
4933434E20Rik A T 3: 90,053,542 Q34L probably damaging Het
4933434E20Rik G T 3: 90,053,583 V48F probably damaging Het
8430408G22Rik T A 6: 116,652,135 C146* probably null Het
Abra T C 15: 41,865,906 D366G probably damaging Het
Acvr2a T C 2: 48,870,435 S68P probably damaging Het
Adam28 T A 14: 68,626,877 R492S probably damaging Het
Adamts1 T A 16: 85,802,505 E69V probably benign Het
Adgra1 A T 7: 139,875,589 M378L probably benign Het
Adgra2 T A 8: 27,098,822 N101K possibly damaging Het
Adhfe1 T A 1: 9,576,250 F449L probably damaging Het
Akap6 T A 12: 52,795,885 S5R possibly damaging Het
Akap9 G A 5: 4,055,339 R2883Q probably benign Het
Ank3 T A 10: 69,706,858 I16N probably benign Het
Api5 A T 2: 94,423,471 F296I possibly damaging Het
Ceacam14 G T 7: 17,814,050 probably null Het
Cep295 C T 9: 15,330,832 G1768S probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cp C A 3: 19,972,647 T413K probably benign Het
Ctdsp2 T G 10: 126,993,069 V104G probably damaging Het
Ctrc T A 4: 141,846,296 probably null Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dctn1 T A 6: 83,189,938 M257K possibly damaging Het
Dlgap5 C T 14: 47,401,520 probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Exoc8 A G 8: 124,897,250 V126A probably benign Het
Fam185a T A 5: 21,455,787 S267T probably damaging Het
Fhod1 T C 8: 105,337,861 probably benign Het
Fn1 T C 1: 71,648,148 probably null Het
Gadl1 A T 9: 115,954,617 T214S possibly damaging Het
Gem G T 4: 11,706,074 R54L probably damaging Het
Ghr A G 15: 3,325,940 V287A probably benign Het
Gm3642 G A 14: 6,833,344 T215I probably benign Het
Grip1 T A 10: 120,038,683 I732K probably benign Het
Gtpbp2 A T 17: 46,167,221 probably null Het
Heatr6 C T 11: 83,779,548 R976* probably null Het
Hipk2 T A 6: 38,698,392 T1084S probably benign Het
Hmcn1 T C 1: 150,694,833 probably null Het
Hspg2 T A 4: 137,522,127 M1328K probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ighv1-64 A G 12: 115,507,846 V17A probably benign Het
Iqgap2 G T 13: 95,635,497 N1391K possibly damaging Het
Irf7 A T 7: 141,264,735 L148Q possibly damaging Het
Kat6b G A 14: 21,660,962 R768K probably benign Het
Lepr G A 4: 101,765,365 W447* probably null Het
Letmd1 A G 15: 100,469,738 Y59C probably damaging Het
Lingo4 A T 3: 94,402,876 K374* probably null Het
Loxl4 G T 19: 42,608,346 D62E probably benign Het
Lrfn2 A G 17: 49,070,434 D181G probably damaging Het
Lrrc71 A T 3: 87,739,174 F526L probably damaging Het
Ltbp1 A T 17: 75,313,008 M711L probably damaging Het
Mcm7 A T 5: 138,169,125 D78E probably damaging Het
Mdh1 T C 11: 21,562,957 N136D probably damaging Het
Meltf T A 16: 31,892,505 N515K probably benign Het
Mis18bp1 T A 12: 65,158,739 T220S probably benign Het
Mtss1 C T 15: 59,081,518 V4M probably damaging Het
Nacc2 A T 2: 26,090,173 F84I probably damaging Het
Nedd9 A G 13: 41,316,597 V360A possibly damaging Het
Nek11 T A 9: 105,392,970 I18F possibly damaging Het
Nkd2 C T 13: 73,847,005 V13M probably damaging Het
Nkx6-3 A G 8: 23,156,269 I152V probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1 A T 11: 73,395,155 I289N probably damaging Het
Olfr1352 A G 10: 78,984,522 H244R probably damaging Het
Olfr1434 T C 19: 12,283,096 L16P probably damaging Het
Olfr215 T C 6: 116,582,937 N3S probably damaging Het
Olfr494 T A 7: 108,367,998 F169L probably benign Het
Olfr66 A G 7: 103,881,649 V198A probably benign Het
Oprm1 A T 10: 6,758,656 R16* probably null Het
Ostf1 G A 19: 18,593,867 P62L probably damaging Het
Pcdha2 A T 18: 36,940,515 T400S possibly damaging Het
Pcdha5 A T 18: 36,961,496 T353S possibly damaging Het
Pelo A G 13: 115,088,735 F318S probably damaging Het
Polr2f T C 15: 79,146,069 V36A probably benign Het
Ppan G A 9: 20,888,510 R41H probably benign Het
Ppp1r21 C T 17: 88,555,591 R253* probably null Het
Prf1 T A 10: 61,303,708 W482R probably damaging Het
Ralgapa2 T C 2: 146,345,533 T1397A possibly damaging Het
Rev3l T A 10: 39,846,806 Y2598* probably null Het
Scaf11 G T 15: 96,414,848 D1437E probably benign Het
Sec23a C T 12: 58,978,506 G510R probably damaging Het
Sel1l2 A G 2: 140,240,927 M597T probably damaging Het
Slc11a2 A T 15: 100,406,338 S160T possibly damaging Het
Slc18a1 A T 8: 69,073,649 L129* probably null Het
Smg8 A C 11: 87,086,221 L178R probably benign Het
Sp4 T C 12: 118,261,809 T607A probably benign Het
Ssbp2 A G 13: 91,688,814 D266G possibly damaging Het
Sstr3 A T 15: 78,539,697 Y283* probably null Het
Stk32b C T 5: 37,454,934 probably null Het
Svep1 T C 4: 58,070,752 T2345A possibly damaging Het
Synpo2 A G 3: 123,114,291 S459P probably damaging Het
Sytl2 A G 7: 90,348,792 M1V probably null Het
Tas2r102 T A 6: 132,762,557 W143R probably damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tlr2 A T 3: 83,838,185 I197N probably damaging Het
Tmem101 A G 11: 102,153,443 I206T probably benign Het
Tmem108 A G 9: 103,499,489 S254P possibly damaging Het
Vangl1 T C 3: 102,184,554 D72G probably damaging Het
Vmn1r4 T A 6: 56,957,364 D284E probably benign Het
Vmn2r31 G A 7: 7,384,758 L605F possibly damaging Het
Zfand4 T C 6: 116,273,819 V70A probably damaging Het
Zfp54 A G 17: 21,433,403 E53G probably damaging Het
Zfp541 A T 7: 16,081,687 I805F probably damaging Het
Zfp976 T C 7: 42,613,033 H460R possibly damaging Het
Other mutations in Tmem198b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Tmem198b APN 10 128803145 missense probably damaging 1.00
IGL02623:Tmem198b APN 10 128802451 missense probably damaging 1.00
R1636:Tmem198b UTSW 10 128802196 missense probably damaging 0.99
R2922:Tmem198b UTSW 10 128802193 missense probably damaging 1.00
R5013:Tmem198b UTSW 10 128802073 missense probably damaging 1.00
R5092:Tmem198b UTSW 10 128801436 missense probably benign
R5107:Tmem198b UTSW 10 128802287 missense probably benign
R5818:Tmem198b UTSW 10 128802188 missense probably benign 0.02
R5930:Tmem198b UTSW 10 128801454 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAAAGGTTCTGGGTCAGAGC -3'
(R):5'- AAATCGCCAGGTGATGCAG -3'

Sequencing Primer
(F):5'- AGCTCATCCTGGCCATCAC -3'
(R):5'- CAGGTGATGCAGAGCACAGTTATTTC -3'
Posted On2015-10-21