Mutagenetix > Incidental Mutations

Incidental Mutation 'R4724:Akap6'

354713

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

041988-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.783) question?

Stock #

R4724 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52795885 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 5 (S5R)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095737
AA Change: S5R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: S5R

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219786
AA Change: S5R

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	C	G	3: 90,053,541	Q34E	probably damaging	Het
4933434E20Rik	A	T	3: 90,053,542	Q34L	probably damaging	Het
4933434E20Rik	G	T	3: 90,053,583	V48F	probably damaging	Het
8430408G22Rik	T	A	6: 116,652,135	C146*	probably null	Het
Abra	T	C	15: 41,865,906	D366G	probably damaging	Het
Acvr2a	T	C	2: 48,870,435	S68P	probably damaging	Het
Adam28	T	A	14: 68,626,877	R492S	probably damaging	Het
Adamts1	T	A	16: 85,802,505	E69V	probably benign	Het
Adgra1	A	T	7: 139,875,589	M378L	probably benign	Het
Adgra2	T	A	8: 27,098,822	N101K	possibly damaging	Het
Adhfe1	T	A	1: 9,576,250	F449L	probably damaging	Het
Akap9	G	A	5: 4,055,339	R2883Q	probably benign	Het
Ank3	T	A	10: 69,706,858	I16N	probably benign	Het
Api5	A	T	2: 94,423,471	F296I	possibly damaging	Het
Ceacam14	G	T	7: 17,814,050		probably null	Het
Cep295	C	T	9: 15,330,832	G1768S	probably damaging	Het
Cldn12	A	G	5: 5,508,385	F14S	probably damaging	Het
Cp	C	A	3: 19,972,647	T413K	probably benign	Het
Ctdsp2	T	G	10: 126,993,069	V104G	probably damaging	Het
Ctrc	T	A	4: 141,846,296		probably null	Het
Dbt	T	C	3: 116,533,296	I98T	probably damaging	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Dctn1	T	A	6: 83,189,938	M257K	possibly damaging	Het
Dlgap5	C	T	14: 47,401,520		probably null	Het
Drd3	G	T	16: 43,822,801	E467*	probably null	Het
Exoc8	A	G	8: 124,897,250	V126A	probably benign	Het
Fam185a	T	A	5: 21,455,787	S267T	probably damaging	Het
Fhod1	T	C	8: 105,337,861		probably benign	Het
Fn1	T	C	1: 71,648,148		probably null	Het
Gadl1	A	T	9: 115,954,617	T214S	possibly damaging	Het
Gem	G	T	4: 11,706,074	R54L	probably damaging	Het
Ghr	A	G	15: 3,325,940	V287A	probably benign	Het
Gm3642	G	A	14: 6,833,344	T215I	probably benign	Het
Grip1	T	A	10: 120,038,683	I732K	probably benign	Het
Gtpbp2	A	T	17: 46,167,221		probably null	Het
Heatr6	C	T	11: 83,779,548	R976*	probably null	Het
Hipk2	T	A	6: 38,698,392	T1084S	probably benign	Het
Hmcn1	T	C	1: 150,694,833		probably null	Het
Hspg2	T	A	4: 137,522,127	M1328K	probably damaging	Het
Ifna4	C	A	4: 88,842,282	T141K	probably benign	Het
Ighv1-64	A	G	12: 115,507,846	V17A	probably benign	Het
Iqgap2	G	T	13: 95,635,497	N1391K	possibly damaging	Het
Irf7	A	T	7: 141,264,735	L148Q	possibly damaging	Het
Kat6b	G	A	14: 21,660,962	R768K	probably benign	Het
Lepr	G	A	4: 101,765,365	W447*	probably null	Het
Letmd1	A	G	15: 100,469,738	Y59C	probably damaging	Het
Lingo4	A	T	3: 94,402,876	K374*	probably null	Het
Loxl4	G	T	19: 42,608,346	D62E	probably benign	Het
Lrfn2	A	G	17: 49,070,434	D181G	probably damaging	Het
Lrrc71	A	T	3: 87,739,174	F526L	probably damaging	Het
Ltbp1	A	T	17: 75,313,008	M711L	probably damaging	Het
Mcm7	A	T	5: 138,169,125	D78E	probably damaging	Het
Mdh1	T	C	11: 21,562,957	N136D	probably damaging	Het
Meltf	T	A	16: 31,892,505	N515K	probably benign	Het
Mis18bp1	T	A	12: 65,158,739	T220S	probably benign	Het
Mtss1	C	T	15: 59,081,518	V4M	probably damaging	Het
Nacc2	A	T	2: 26,090,173	F84I	probably damaging	Het
Nedd9	A	G	13: 41,316,597	V360A	possibly damaging	Het
Nek11	T	A	9: 105,392,970	I18F	possibly damaging	Het
Nkd2	C	T	13: 73,847,005	V13M	probably damaging	Het
Nkx6-3	A	G	8: 23,156,269	I152V	probably damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Olfr1	A	T	11: 73,395,155	I289N	probably damaging	Het
Olfr1352	A	G	10: 78,984,522	H244R	probably damaging	Het
Olfr1434	T	C	19: 12,283,096	L16P	probably damaging	Het
Olfr215	T	C	6: 116,582,937	N3S	probably damaging	Het
Olfr494	T	A	7: 108,367,998	F169L	probably benign	Het
Olfr66	A	G	7: 103,881,649	V198A	probably benign	Het
Oprm1	A	T	10: 6,758,656	R16*	probably null	Het
Ostf1	G	A	19: 18,593,867	P62L	probably damaging	Het
Pcdha2	A	T	18: 36,940,515	T400S	possibly damaging	Het
Pcdha5	A	T	18: 36,961,496	T353S	possibly damaging	Het
Pelo	A	G	13: 115,088,735	F318S	probably damaging	Het
Polr2f	T	C	15: 79,146,069	V36A	probably benign	Het
Ppan	G	A	9: 20,888,510	R41H	probably benign	Het
Ppp1r21	C	T	17: 88,555,591	R253*	probably null	Het
Prf1	T	A	10: 61,303,708	W482R	probably damaging	Het
Ralgapa2	T	C	2: 146,345,533	T1397A	possibly damaging	Het
Rev3l	T	A	10: 39,846,806	Y2598*	probably null	Het
Scaf11	G	T	15: 96,414,848	D1437E	probably benign	Het
Sec23a	C	T	12: 58,978,506	G510R	probably damaging	Het
Sel1l2	A	G	2: 140,240,927	M597T	probably damaging	Het
Slc11a2	A	T	15: 100,406,338	S160T	possibly damaging	Het
Slc18a1	A	T	8: 69,073,649	L129*	probably null	Het
Smg8	A	C	11: 87,086,221	L178R	probably benign	Het
Sp4	T	C	12: 118,261,809	T607A	probably benign	Het
Ssbp2	A	G	13: 91,688,814	D266G	possibly damaging	Het
Sstr3	A	T	15: 78,539,697	Y283*	probably null	Het
Stk32b	C	T	5: 37,454,934		probably null	Het
Svep1	T	C	4: 58,070,752	T2345A	possibly damaging	Het
Synpo2	A	G	3: 123,114,291	S459P	probably damaging	Het
Sytl2	A	G	7: 90,348,792	M1V	probably null	Het
Tas2r102	T	A	6: 132,762,557	W143R	probably damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tlr2	A	T	3: 83,838,185	I197N	probably damaging	Het
Tmem101	A	G	11: 102,153,443	I206T	probably benign	Het
Tmem108	A	G	9: 103,499,489	S254P	possibly damaging	Het
Tmem198b	T	C	10: 128,801,481	Q263R	probably damaging	Het
Vangl1	T	C	3: 102,184,554	D72G	probably damaging	Het
Vmn1r4	T	A	6: 56,957,364	D284E	probably benign	Het
Vmn2r31	G	A	7: 7,384,758	L605F	possibly damaging	Het
Zfand4	T	C	6: 116,273,819	V70A	probably damaging	Het
Zfp54	A	G	17: 21,433,403	E53G	probably damaging	Het
Zfp541	A	T	7: 16,081,687	I805F	probably damaging	Het
Zfp976	T	C	7: 42,613,033	H460R	possibly damaging	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCATGCTCTTGTGTTACTTACTGGG -3'
(R):5'- ACAATCTTCCAGTCGGCTGC -3'

Sequencing Primer
(F):5'- AATCAAAACCCCTCTTTCTGTTTTTG -3'
(R):5'- CCAGTCGGCTGCTGTGTG -3'

Posted On

2015-10-21