Incidental Mutation 'R4724:Iqgap2'
ID 354721
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene Name IQ motif containing GTPase activating protein 2
Synonyms 4933417J23Rik
MMRRC Submission 041988-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4724 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 95763685-96028788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 95772005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1391 (N1391K)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
AlphaFold Q3UQ44
Predicted Effect possibly damaging
Transcript: ENSMUST00000068603
AA Change: N1391K

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: N1391K

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C G 3: 89,960,848 (GRCm39) Q34E probably damaging Het
4933434E20Rik G T 3: 89,960,890 (GRCm39) V48F probably damaging Het
4933434E20Rik A T 3: 89,960,849 (GRCm39) Q34L probably damaging Het
Abra T C 15: 41,729,302 (GRCm39) D366G probably damaging Het
Acvr2a T C 2: 48,760,447 (GRCm39) S68P probably damaging Het
Adam28 T A 14: 68,864,326 (GRCm39) R492S probably damaging Het
Adamts1 T A 16: 85,599,393 (GRCm39) E69V probably benign Het
Adgra1 A T 7: 139,455,505 (GRCm39) M378L probably benign Het
Adgra2 T A 8: 27,588,850 (GRCm39) N101K possibly damaging Het
Adhfe1 T A 1: 9,646,475 (GRCm39) F449L probably damaging Het
Akap6 T A 12: 52,842,668 (GRCm39) S5R possibly damaging Het
Akap9 G A 5: 4,105,339 (GRCm39) R2883Q probably benign Het
Ank3 T A 10: 69,542,688 (GRCm39) I16N probably benign Het
Api5 A T 2: 94,253,816 (GRCm39) F296I possibly damaging Het
Ceacam14 G T 7: 17,547,975 (GRCm39) probably null Het
Cep295 C T 9: 15,242,128 (GRCm39) G1768S probably damaging Het
Cldn12 A G 5: 5,558,385 (GRCm39) F14S probably damaging Het
Cp C A 3: 20,026,811 (GRCm39) T413K probably benign Het
Ctdsp2 T G 10: 126,828,938 (GRCm39) V104G probably damaging Het
Ctrc T A 4: 141,573,607 (GRCm39) probably null Het
Dbt T C 3: 116,326,945 (GRCm39) I98T probably damaging Het
Dcaf10 G A 4: 45,372,769 (GRCm39) R394Q possibly damaging Het
Dctn1 T A 6: 83,166,920 (GRCm39) M257K possibly damaging Het
Depp1 T A 6: 116,629,096 (GRCm39) C146* probably null Het
Dlgap5 C T 14: 47,638,977 (GRCm39) probably null Het
Drd3 G T 16: 43,643,164 (GRCm39) E467* probably null Het
Exoc8 A G 8: 125,623,989 (GRCm39) V126A probably benign Het
Fam185a T A 5: 21,660,785 (GRCm39) S267T probably damaging Het
Fhod1 T C 8: 106,064,493 (GRCm39) probably benign Het
Fn1 T C 1: 71,687,307 (GRCm39) probably null Het
Gadl1 A T 9: 115,783,685 (GRCm39) T214S possibly damaging Het
Gem G T 4: 11,706,074 (GRCm39) R54L probably damaging Het
Ghr A G 15: 3,355,422 (GRCm39) V287A probably benign Het
Gm3642 G A 14: 18,212,879 (GRCm39) T215I probably benign Het
Grip1 T A 10: 119,874,588 (GRCm39) I732K probably benign Het
Gtpbp2 A T 17: 46,478,147 (GRCm39) probably null Het
Heatr6 C T 11: 83,670,374 (GRCm39) R976* probably null Het
Hipk2 T A 6: 38,675,327 (GRCm39) T1084S probably benign Het
Hmcn1 T C 1: 150,570,584 (GRCm39) probably null Het
Hspg2 T A 4: 137,249,438 (GRCm39) M1328K probably damaging Het
Ifna4 C A 4: 88,760,519 (GRCm39) T141K probably benign Het
Ighv1-64 A G 12: 115,471,466 (GRCm39) V17A probably benign Het
Irf7 A T 7: 140,844,648 (GRCm39) L148Q possibly damaging Het
Kat6b G A 14: 21,711,030 (GRCm39) R768K probably benign Het
Lepr G A 4: 101,622,562 (GRCm39) W447* probably null Het
Letmd1 A G 15: 100,367,619 (GRCm39) Y59C probably damaging Het
Lingo4 A T 3: 94,310,183 (GRCm39) K374* probably null Het
Loxl4 G T 19: 42,596,785 (GRCm39) D62E probably benign Het
Lrfn2 A G 17: 49,377,462 (GRCm39) D181G probably damaging Het
Lrrc71 A T 3: 87,646,481 (GRCm39) F526L probably damaging Het
Ltbp1 A T 17: 75,620,003 (GRCm39) M711L probably damaging Het
Mcm7 A T 5: 138,167,387 (GRCm39) D78E probably damaging Het
Mdh1 T C 11: 21,512,957 (GRCm39) N136D probably damaging Het
Meltf T A 16: 31,711,323 (GRCm39) N515K probably benign Het
Mis18bp1 T A 12: 65,205,513 (GRCm39) T220S probably benign Het
Mtss1 C T 15: 58,953,367 (GRCm39) V4M probably damaging Het
Nacc2 A T 2: 25,980,185 (GRCm39) F84I probably damaging Het
Nedd9 A G 13: 41,470,073 (GRCm39) V360A possibly damaging Het
Nek11 T A 9: 105,270,169 (GRCm39) I18F possibly damaging Het
Nkd2 C T 13: 73,995,124 (GRCm39) V13M probably damaging Het
Nkx6-3 A G 8: 23,646,285 (GRCm39) I152V probably damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Oprm1 A T 10: 6,708,656 (GRCm39) R16* probably null Het
Or1e16 A T 11: 73,285,981 (GRCm39) I289N probably damaging Het
Or51b4 A G 7: 103,530,856 (GRCm39) V198A probably benign Het
Or5an1 T C 19: 12,260,460 (GRCm39) L16P probably damaging Het
Or5p69 T A 7: 107,967,205 (GRCm39) F169L probably benign Het
Or6d15 T C 6: 116,559,898 (GRCm39) N3S probably damaging Het
Or7a36 A G 10: 78,820,356 (GRCm39) H244R probably damaging Het
Ostf1 G A 19: 18,571,231 (GRCm39) P62L probably damaging Het
Pcdha2 A T 18: 37,073,568 (GRCm39) T400S possibly damaging Het
Pcdha5 A T 18: 37,094,549 (GRCm39) T353S possibly damaging Het
Pelo A G 13: 115,225,271 (GRCm39) F318S probably damaging Het
Polr2f T C 15: 79,030,269 (GRCm39) V36A probably benign Het
Ppan G A 9: 20,799,806 (GRCm39) R41H probably benign Het
Ppp1r21 C T 17: 88,863,019 (GRCm39) R253* probably null Het
Prf1 T A 10: 61,139,487 (GRCm39) W482R probably damaging Het
Ralgapa2 T C 2: 146,187,453 (GRCm39) T1397A possibly damaging Het
Rev3l T A 10: 39,722,802 (GRCm39) Y2598* probably null Het
Scaf11 G T 15: 96,312,729 (GRCm39) D1437E probably benign Het
Sec23a C T 12: 59,025,292 (GRCm39) G510R probably damaging Het
Sel1l2 A G 2: 140,082,847 (GRCm39) M597T probably damaging Het
Slc11a2 A T 15: 100,304,219 (GRCm39) S160T possibly damaging Het
Slc18a1 A T 8: 69,526,301 (GRCm39) L129* probably null Het
Smg8 A C 11: 86,977,047 (GRCm39) L178R probably benign Het
Sp4 T C 12: 118,225,544 (GRCm39) T607A probably benign Het
Ssbp2 A G 13: 91,836,933 (GRCm39) D266G possibly damaging Het
Sstr3 A T 15: 78,423,897 (GRCm39) Y283* probably null Het
Stk32b C T 5: 37,612,278 (GRCm39) probably null Het
Svep1 T C 4: 58,070,752 (GRCm39) T2345A possibly damaging Het
Synpo2 A G 3: 122,907,940 (GRCm39) S459P probably damaging Het
Sytl2 A G 7: 89,998,000 (GRCm39) M1V probably null Het
Tas2r102 T A 6: 132,739,520 (GRCm39) W143R probably damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tlr2 A T 3: 83,745,492 (GRCm39) I197N probably damaging Het
Tmem101 A G 11: 102,044,269 (GRCm39) I206T probably benign Het
Tmem108 A G 9: 103,376,688 (GRCm39) S254P possibly damaging Het
Tmem198b T C 10: 128,637,350 (GRCm39) Q263R probably damaging Het
Vangl1 T C 3: 102,091,870 (GRCm39) D72G probably damaging Het
Vmn1r4 T A 6: 56,934,349 (GRCm39) D284E probably benign Het
Vmn2r31 G A 7: 7,387,757 (GRCm39) L605F possibly damaging Het
Zfand4 T C 6: 116,250,780 (GRCm39) V70A probably damaging Het
Zfp54 A G 17: 21,653,665 (GRCm39) E53G probably damaging Het
Zfp541 A T 7: 15,815,612 (GRCm39) I805F probably damaging Het
Zfp976 T C 7: 42,262,457 (GRCm39) H460R possibly damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95,794,452 (GRCm39) splice site probably benign
IGL01968:Iqgap2 APN 13 95,772,090 (GRCm39) missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95,811,913 (GRCm39) splice site probably benign
IGL02195:Iqgap2 APN 13 95,798,242 (GRCm39) splice site probably benign
IGL02387:Iqgap2 APN 13 95,826,209 (GRCm39) missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95,764,622 (GRCm39) missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95,764,564 (GRCm39) missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95,807,912 (GRCm39) missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95,861,184 (GRCm39) missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95,798,243 (GRCm39) splice site probably benign
IGL03167:Iqgap2 APN 13 95,821,406 (GRCm39) missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95,867,785 (GRCm39) splice site probably null
IGL03293:Iqgap2 APN 13 95,867,942 (GRCm39) missense probably damaging 1.00
G1Funyon:Iqgap2 UTSW 13 95,818,659 (GRCm39) critical splice donor site probably null
R0257:Iqgap2 UTSW 13 95,861,052 (GRCm39) critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95,772,141 (GRCm39) missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95,867,783 (GRCm39) splice site probably benign
R0364:Iqgap2 UTSW 13 95,867,783 (GRCm39) splice site probably benign
R0419:Iqgap2 UTSW 13 95,826,207 (GRCm39) critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95,768,673 (GRCm39) missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95,805,021 (GRCm39) missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95,768,673 (GRCm39) missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95,783,313 (GRCm39) missense probably benign
R1513:Iqgap2 UTSW 13 95,766,518 (GRCm39) missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95,826,293 (GRCm39) missense probably benign
R2088:Iqgap2 UTSW 13 96,028,171 (GRCm39) critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95,818,744 (GRCm39) missense probably benign
R3026:Iqgap2 UTSW 13 95,809,564 (GRCm39) critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95,805,036 (GRCm39) splice site probably null
R3846:Iqgap2 UTSW 13 95,810,186 (GRCm39) splice site probably benign
R4056:Iqgap2 UTSW 13 95,886,541 (GRCm39) missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95,794,375 (GRCm39) missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95,807,904 (GRCm39) missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95,800,569 (GRCm39) critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95,899,837 (GRCm39) missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95,858,117 (GRCm39) missense probably damaging 0.98
R4826:Iqgap2 UTSW 13 95,899,783 (GRCm39) missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95,810,251 (GRCm39) missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95,766,514 (GRCm39) missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95,794,305 (GRCm39) splice site probably null
R5010:Iqgap2 UTSW 13 95,810,251 (GRCm39) missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95,772,088 (GRCm39) missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95,766,561 (GRCm39) missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95,811,884 (GRCm39) nonsense probably null
R5629:Iqgap2 UTSW 13 95,768,682 (GRCm39) missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95,811,880 (GRCm39) missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95,772,118 (GRCm39) missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95,768,550 (GRCm39) missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95,765,471 (GRCm39) missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95,858,194 (GRCm39) splice site probably null
R6404:Iqgap2 UTSW 13 95,865,985 (GRCm39) missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95,819,441 (GRCm39) missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95,818,719 (GRCm39) missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95,796,840 (GRCm39) missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95,797,565 (GRCm39) missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95,765,480 (GRCm39) missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95,772,163 (GRCm39) missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95,836,846 (GRCm39) splice site probably null
R7378:Iqgap2 UTSW 13 95,869,398 (GRCm39) critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95,764,584 (GRCm39) missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95,798,131 (GRCm39) missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95,764,627 (GRCm39) missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95,867,952 (GRCm39) missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95,818,765 (GRCm39) missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95,826,217 (GRCm39) missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95,794,387 (GRCm39) missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95,861,076 (GRCm39) missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95,772,078 (GRCm39) missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95,818,659 (GRCm39) critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95,798,111 (GRCm39) missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95,796,659 (GRCm39) missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95,796,713 (GRCm39) missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95,796,756 (GRCm39) missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95,802,258 (GRCm39) missense probably damaging 1.00
R8845:Iqgap2 UTSW 13 95,794,392 (GRCm39) missense possibly damaging 0.60
R8902:Iqgap2 UTSW 13 95,818,711 (GRCm39) missense probably benign 0.16
R8957:Iqgap2 UTSW 13 95,772,154 (GRCm39) missense probably damaging 1.00
R9153:Iqgap2 UTSW 13 95,844,547 (GRCm39) missense probably benign
R9259:Iqgap2 UTSW 13 95,766,561 (GRCm39) missense probably damaging 1.00
R9290:Iqgap2 UTSW 13 95,886,523 (GRCm39) missense probably damaging 1.00
R9414:Iqgap2 UTSW 13 95,783,349 (GRCm39) missense
R9432:Iqgap2 UTSW 13 95,774,261 (GRCm39) missense probably benign
R9747:Iqgap2 UTSW 13 95,821,505 (GRCm39) missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95,807,891 (GRCm39) missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95,867,951 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCCTGGTGTGTTTGCACTC -3'
(R):5'- TCTTTAGGAACTAGAGCACGCC -3'

Sequencing Primer
(F):5'- CCTGGGGGAGCTGTATCAATTCC -3'
(R):5'- CTAGAGCACGCCAAAGACATGG -3'
Posted On 2015-10-21