Incidental Mutation 'R4689:Slc39a10'
ID354749
Institutional Source Beutler Lab
Gene Symbol Slc39a10
Ensembl Gene ENSMUSG00000025986
Gene Namesolute carrier family 39 (zinc transporter), member 10
Synonyms2900042E17Rik
MMRRC Submission 041940-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R4689 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location46807544-46892852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 46836013 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 43 (M43R)
Ref Sequence ENSEMBL: ENSMUSP00000140176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027131] [ENSMUST00000185520] [ENSMUST00000186852]
Predicted Effect probably benign
Transcript: ENSMUST00000027131
AA Change: M43R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986
AA Change: M43R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
low complexity region 224 244 N/A INTRINSIC
Pfam:Zip 406 607 9.9e-44 PFAM
Pfam:Zip 588 821 2.5e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141226
Predicted Effect probably benign
Transcript: ENSMUST00000185520
AA Change: M53R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140570
Gene: ENSMUSG00000025986
AA Change: M53R

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186852
AA Change: M43R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140176
Gene: ENSMUSG00000025986
AA Change: M43R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C A 17: 46,324,070 V336L probably benign Het
Acbd4 T C 11: 103,105,368 L165P possibly damaging Het
Adam10 T C 9: 70,765,954 S456P possibly damaging Het
Adgre4 T C 17: 55,802,096 F368L probably damaging Het
Ahcyl1 G T 3: 107,665,518 Y528* probably null Het
Aldh3b3 G A 19: 3,964,516 V84M probably damaging Het
Cdca8 C T 4: 124,931,103 G78E probably damaging Het
Cry2 T C 2: 92,424,554 D152G probably benign Het
Cyp2c67 T C 19: 39,638,588 Y266C probably benign Het
Dkk4 T C 8: 22,625,320 F62S probably benign Het
Dnah12 G A 14: 26,706,839 V207I probably benign Het
Dthd1 T C 5: 62,842,912 C526R probably damaging Het
Dubr A T 16: 50,732,503 noncoding transcript Het
F5 T C 1: 164,151,973 probably benign Het
Flcn A C 11: 59,801,044 W260G possibly damaging Het
Fmnl1 G A 11: 103,193,736 probably null Het
Frem2 A T 3: 53,547,635 D2173E probably benign Het
Fstl4 C T 11: 53,068,650 Q173* probably null Het
Gfra3 G A 18: 34,690,587 P381S unknown Het
Gm28308 C A 6: 52,213,311 probably benign Het
Gm8394 T A 10: 85,314,201 noncoding transcript Het
Gm8730 T A 8: 102,865,747 noncoding transcript Het
Gzmd T C 14: 56,131,226 probably null Het
Hexb A G 13: 97,181,092 Y366H probably damaging Het
Hydin A T 8: 110,595,414 H4566L probably benign Het
Ifi213 G A 1: 173,590,420 T142I possibly damaging Het
Kif13b T A 14: 64,773,064 C1271S probably damaging Het
Krtap9-5 G T 11: 99,949,460 C329F unknown Het
Larp1 G T 11: 58,041,613 G207W probably damaging Het
Lfng A G 5: 140,614,439 D368G probably damaging Het
Mbd5 G A 2: 49,258,279 V834I possibly damaging Het
Mterf1b T A 5: 4,197,263 Y301* probably null Het
Myh7b T C 2: 155,630,514 I1305T possibly damaging Het
Myo16 T C 8: 10,438,890 V687A probably damaging Het
Naip2 A T 13: 100,148,812 I1292N probably damaging Het
Nmral1 A G 16: 4,714,558 F130L probably damaging Het
Nos1 A G 5: 117,879,385 N271S probably benign Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Olfr106-ps A T 17: 37,394,771 N77I probably damaging Het
Olfr1509 T C 14: 52,451,214 I267T probably benign Het
Olfr169 A T 16: 19,566,513 Y123* probably null Het
Olfr800 T C 10: 129,660,316 V170A probably benign Het
Pkdcc C G 17: 83,215,861 C132W probably damaging Het
Plekhg6 G A 6: 125,373,181 L265F probably benign Het
Prkaa1 A G 15: 5,178,696 T473A probably benign Het
Prpf3 G A 3: 95,836,489 Q451* probably null Het
Ptprh T A 7: 4,597,997 D127V possibly damaging Het
Rab36 T C 10: 75,041,933 probably null Het
Rasa1 A T 13: 85,238,163 Y427* probably null Het
Rgs11 T C 17: 26,204,547 probably null Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Shank2 G A 7: 144,420,605 V1087I probably benign Het
Slc40a1 T A 1: 45,912,313 Q228L probably benign Het
Slc45a1 A T 4: 150,638,539 L296Q probably benign Het
Stambpl1 A G 19: 34,236,291 T307A probably benign Het
Stt3a T C 9: 36,732,929 T705A possibly damaging Het
Tec G A 5: 72,823,637 probably benign Het
Trp63 A T 16: 25,865,262 T300S possibly damaging Het
Vmn1r235 A G 17: 21,262,361 H316R probably benign Het
Vmn2r1 A G 3: 64,104,653 H645R possibly damaging Het
Wdfy4 A G 14: 33,109,548 I907T possibly damaging Het
Zcchc10 A G 11: 53,327,324 T33A probably benign Het
Zfp318 T A 17: 46,399,634 V761D probably damaging Het
Zfp358 T C 8: 3,496,146 probably null Het
Zfp661 G A 2: 127,577,548 P224L probably damaging Het
Zfp937 T C 2: 150,236,786 M33T probably damaging Het
Zfp955a T C 17: 33,242,066 H364R probably damaging Het
Other mutations in Slc39a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Slc39a10 APN 1 46819057 splice site probably benign
IGL01628:Slc39a10 APN 1 46835523 missense probably benign 0.23
IGL01939:Slc39a10 APN 1 46832735 missense probably benign 0.07
IGL02068:Slc39a10 APN 1 46819439 splice site probably benign
IGL02093:Slc39a10 APN 1 46835209 missense probably damaging 1.00
IGL02101:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02122:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02125:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02171:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02175:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02186:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02699:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02700:Slc39a10 APN 1 46818128 missense probably damaging 1.00
R0217:Slc39a10 UTSW 1 46835540 missense probably benign
R0704:Slc39a10 UTSW 1 46835861 missense possibly damaging 0.76
R0782:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R1527:Slc39a10 UTSW 1 46819262 missense probably benign
R1566:Slc39a10 UTSW 1 46836085 missense possibly damaging 0.90
R1568:Slc39a10 UTSW 1 46826215 missense probably benign 0.00
R1664:Slc39a10 UTSW 1 46826109 missense probably damaging 1.00
R1830:Slc39a10 UTSW 1 46836070 missense probably damaging 1.00
R1954:Slc39a10 UTSW 1 46835174 missense possibly damaging 0.50
R2327:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R3434:Slc39a10 UTSW 1 46835717 missense probably benign
R3761:Slc39a10 UTSW 1 46812125 missense possibly damaging 0.88
R4035:Slc39a10 UTSW 1 46812074 missense probably damaging 1.00
R4419:Slc39a10 UTSW 1 46810066 missense probably benign 0.42
R4675:Slc39a10 UTSW 1 46817984 intron probably benign
R5310:Slc39a10 UTSW 1 46836125 missense probably damaging 1.00
R6073:Slc39a10 UTSW 1 46832612 missense possibly damaging 0.68
R6161:Slc39a10 UTSW 1 46827407 missense probably damaging 1.00
R6199:Slc39a10 UTSW 1 46835833 missense probably damaging 1.00
R6562:Slc39a10 UTSW 1 46835564 missense probably benign 0.02
R7087:Slc39a10 UTSW 1 46835720 missense probably damaging 1.00
R7222:Slc39a10 UTSW 1 46819292 missense possibly damaging 0.82
R7286:Slc39a10 UTSW 1 46810070 missense probably damaging 0.97
R7568:Slc39a10 UTSW 1 46835130 missense probably benign 0.14
R7891:Slc39a10 UTSW 1 46812168 missense probably damaging 1.00
R7974:Slc39a10 UTSW 1 46812168 missense probably damaging 1.00
RF020:Slc39a10 UTSW 1 46810015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTGCCAGAATGTCTAAGTGAG -3'
(R):5'- TGTTGGCATACACTAATCAGCTG -3'

Sequencing Primer
(F):5'- ATGGCCAAGGTCCTCGTGATTAATC -3'
(R):5'- AGCTGTCTTTTTCAATCCCTGTAGG -3'
Posted On2015-10-21