Incidental Mutation 'R4689:Prpf3'
ID354760
Institutional Source Beutler Lab
Gene Symbol Prpf3
Ensembl Gene ENSMUSG00000015748
Gene Namepre-mRNA processing factor 3
Synonyms
MMRRC Submission 041940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4689 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95830124-95855885 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 95836489 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 451 (Q451*)
Ref Sequence ENSEMBL: ENSMUSP00000124950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015892] [ENSMUST00000159901] [ENSMUST00000161476]
Predicted Effect probably null
Transcript: ENSMUST00000015892
AA Change: Q451*
SMART Domains Protein: ENSMUSP00000015892
Gene: ENSMUSG00000015748
AA Change: Q451*

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 308 521 1.3e-82 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 544 673 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159901
SMART Domains Protein: ENSMUSP00000124444
Gene: ENSMUSG00000015748

DomainStartEndE-ValueType
Pfam:DUF1115 1 105 3.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160155
Predicted Effect probably null
Transcript: ENSMUST00000161476
AA Change: Q451*
SMART Domains Protein: ENSMUSP00000124950
Gene: ENSMUSG00000015748
AA Change: Q451*

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 307 522 5.4e-74 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 543 674 3.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163059
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The removal of introns from nuclear pre-mRNAs occurs on complexes called spliceosomes, which are made up of 4 small nuclear ribonucleoprotein (snRNP) particles and an undefined number of transiently associated splicing factors. This gene product is one of several proteins that associate with U4 and U6 snRNPs. Mutations in this gene are associated with retinitis pigmentosa-18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C A 17: 46,324,070 V336L probably benign Het
Acbd4 T C 11: 103,105,368 L165P possibly damaging Het
Adam10 T C 9: 70,765,954 S456P possibly damaging Het
Adgre4 T C 17: 55,802,096 F368L probably damaging Het
Ahcyl1 G T 3: 107,665,518 Y528* probably null Het
Aldh3b3 G A 19: 3,964,516 V84M probably damaging Het
Cdca8 C T 4: 124,931,103 G78E probably damaging Het
Cry2 T C 2: 92,424,554 D152G probably benign Het
Cyp2c67 T C 19: 39,638,588 Y266C probably benign Het
Dkk4 T C 8: 22,625,320 F62S probably benign Het
Dnah12 G A 14: 26,706,839 V207I probably benign Het
Dthd1 T C 5: 62,842,912 C526R probably damaging Het
Dubr A T 16: 50,732,503 noncoding transcript Het
F5 T C 1: 164,151,973 probably benign Het
Flcn A C 11: 59,801,044 W260G possibly damaging Het
Fmnl1 G A 11: 103,193,736 probably null Het
Frem2 A T 3: 53,547,635 D2173E probably benign Het
Fstl4 C T 11: 53,068,650 Q173* probably null Het
Gfra3 G A 18: 34,690,587 P381S unknown Het
Gm28308 C A 6: 52,213,311 probably benign Het
Gm8394 T A 10: 85,314,201 noncoding transcript Het
Gm8730 T A 8: 102,865,747 noncoding transcript Het
Gzmd T C 14: 56,131,226 probably null Het
Hexb A G 13: 97,181,092 Y366H probably damaging Het
Hydin A T 8: 110,595,414 H4566L probably benign Het
Ifi213 G A 1: 173,590,420 T142I possibly damaging Het
Kif13b T A 14: 64,773,064 C1271S probably damaging Het
Krtap9-5 G T 11: 99,949,460 C329F unknown Het
Larp1 G T 11: 58,041,613 G207W probably damaging Het
Lfng A G 5: 140,614,439 D368G probably damaging Het
Mbd5 G A 2: 49,258,279 V834I possibly damaging Het
Mterf1b T A 5: 4,197,263 Y301* probably null Het
Myh7b T C 2: 155,630,514 I1305T possibly damaging Het
Myo16 T C 8: 10,438,890 V687A probably damaging Het
Naip2 A T 13: 100,148,812 I1292N probably damaging Het
Nmral1 A G 16: 4,714,558 F130L probably damaging Het
Nos1 A G 5: 117,879,385 N271S probably benign Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Olfr106-ps A T 17: 37,394,771 N77I probably damaging Het
Olfr1509 T C 14: 52,451,214 I267T probably benign Het
Olfr169 A T 16: 19,566,513 Y123* probably null Het
Olfr800 T C 10: 129,660,316 V170A probably benign Het
Pkdcc C G 17: 83,215,861 C132W probably damaging Het
Plekhg6 G A 6: 125,373,181 L265F probably benign Het
Prkaa1 A G 15: 5,178,696 T473A probably benign Het
Ptprh T A 7: 4,597,997 D127V possibly damaging Het
Rab36 T C 10: 75,041,933 probably null Het
Rasa1 A T 13: 85,238,163 Y427* probably null Het
Rgs11 T C 17: 26,204,547 probably null Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Shank2 G A 7: 144,420,605 V1087I probably benign Het
Slc39a10 A C 1: 46,836,013 M43R probably benign Het
Slc40a1 T A 1: 45,912,313 Q228L probably benign Het
Slc45a1 A T 4: 150,638,539 L296Q probably benign Het
Stambpl1 A G 19: 34,236,291 T307A probably benign Het
Stt3a T C 9: 36,732,929 T705A possibly damaging Het
Tec G A 5: 72,823,637 probably benign Het
Trp63 A T 16: 25,865,262 T300S possibly damaging Het
Vmn1r235 A G 17: 21,262,361 H316R probably benign Het
Vmn2r1 A G 3: 64,104,653 H645R possibly damaging Het
Wdfy4 A G 14: 33,109,548 I907T possibly damaging Het
Zcchc10 A G 11: 53,327,324 T33A probably benign Het
Zfp318 T A 17: 46,399,634 V761D probably damaging Het
Zfp358 T C 8: 3,496,146 probably null Het
Zfp661 G A 2: 127,577,548 P224L probably damaging Het
Zfp937 T C 2: 150,236,786 M33T probably damaging Het
Zfp955a T C 17: 33,242,066 H364R probably damaging Het
Other mutations in Prpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02175:Prpf3 APN 3 95834107 missense probably damaging 0.99
IGL02825:Prpf3 APN 3 95853480 missense probably damaging 1.00
R0940:Prpf3 UTSW 3 95844223 missense probably damaging 1.00
R1542:Prpf3 UTSW 3 95836470 missense probably benign 0.08
R1545:Prpf3 UTSW 3 95847803 missense probably damaging 0.99
R2063:Prpf3 UTSW 3 95844239 missense probably benign
R2084:Prpf3 UTSW 3 95848989 missense probably benign 0.44
R2160:Prpf3 UTSW 3 95845230 missense probably benign 0.19
R3110:Prpf3 UTSW 3 95849800 intron probably benign
R3112:Prpf3 UTSW 3 95849800 intron probably benign
R4636:Prpf3 UTSW 3 95834170 missense probably damaging 0.99
R4671:Prpf3 UTSW 3 95851664 missense possibly damaging 0.76
R4702:Prpf3 UTSW 3 95834092 missense probably damaging 0.97
R5080:Prpf3 UTSW 3 95833797 missense probably benign 0.45
R5177:Prpf3 UTSW 3 95849724 intron probably benign
R5290:Prpf3 UTSW 3 95853545 missense probably benign 0.39
R5397:Prpf3 UTSW 3 95853579 missense probably benign 0.09
R6329:Prpf3 UTSW 3 95832578 missense probably damaging 1.00
R7133:Prpf3 UTSW 3 95833740 splice site probably null
X0063:Prpf3 UTSW 3 95840715 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCTGCCAGAAGAAAACATCACAG -3'
(R):5'- CAAAGCACGACTGTCTCTCG -3'

Sequencing Primer
(F):5'- GACTGACTCACTCACTCT -3'
(R):5'- GCACGACTGTCTCTCGACCTC -3'
Posted On2015-10-21