Incidental Mutation 'R4689:Shank2'
ID354771
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission 041940-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4689 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144420605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1087 (V1087I)
Ref Sequence ENSEMBL: ENSMUSP00000146440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]
Predicted Effect probably benign
Transcript: ENSMUST00000097929
AA Change: V1080I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: V1080I

DomainStartEndE-ValueType
PDZ 46 131 1.75e-14 SMART
low complexity region 135 154 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 814 828 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 915 937 N/A INTRINSIC
low complexity region 951 967 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
low complexity region 1077 1091 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
SAM 1196 1262 2.52e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105900
AA Change: V1297I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: V1297I

DomainStartEndE-ValueType
SH3 150 205 1.04e-14 SMART
PDZ 256 341 1.75e-14 SMART
low complexity region 345 364 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 829 847 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
low complexity region 1125 1147 N/A INTRINSIC
low complexity region 1161 1177 N/A INTRINSIC
low complexity region 1199 1207 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
SAM 1406 1472 2.52e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105902
AA Change: V1666I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: V1666I

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136979
Predicted Effect probably benign
Transcript: ENSMUST00000146006
AA Change: V1087I

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0642 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C A 17: 46,324,070 V336L probably benign Het
Acbd4 T C 11: 103,105,368 L165P possibly damaging Het
Adam10 T C 9: 70,765,954 S456P possibly damaging Het
Adgre4 T C 17: 55,802,096 F368L probably damaging Het
Ahcyl1 G T 3: 107,665,518 Y528* probably null Het
Aldh3b3 G A 19: 3,964,516 V84M probably damaging Het
Cdca8 C T 4: 124,931,103 G78E probably damaging Het
Cry2 T C 2: 92,424,554 D152G probably benign Het
Cyp2c67 T C 19: 39,638,588 Y266C probably benign Het
Dkk4 T C 8: 22,625,320 F62S probably benign Het
Dnah12 G A 14: 26,706,839 V207I probably benign Het
Dthd1 T C 5: 62,842,912 C526R probably damaging Het
Dubr A T 16: 50,732,503 noncoding transcript Het
F5 T C 1: 164,151,973 probably benign Het
Flcn A C 11: 59,801,044 W260G possibly damaging Het
Fmnl1 G A 11: 103,193,736 probably null Het
Frem2 A T 3: 53,547,635 D2173E probably benign Het
Fstl4 C T 11: 53,068,650 Q173* probably null Het
Gfra3 G A 18: 34,690,587 P381S unknown Het
Gm28308 C A 6: 52,213,311 probably benign Het
Gm8394 T A 10: 85,314,201 noncoding transcript Het
Gm8730 T A 8: 102,865,747 noncoding transcript Het
Gzmd T C 14: 56,131,226 probably null Het
Hexb A G 13: 97,181,092 Y366H probably damaging Het
Hydin A T 8: 110,595,414 H4566L probably benign Het
Ifi213 G A 1: 173,590,420 T142I possibly damaging Het
Kif13b T A 14: 64,773,064 C1271S probably damaging Het
Krtap9-5 G T 11: 99,949,460 C329F unknown Het
Larp1 G T 11: 58,041,613 G207W probably damaging Het
Lfng A G 5: 140,614,439 D368G probably damaging Het
Mbd5 G A 2: 49,258,279 V834I possibly damaging Het
Mterf1b T A 5: 4,197,263 Y301* probably null Het
Myh7b T C 2: 155,630,514 I1305T possibly damaging Het
Myo16 T C 8: 10,438,890 V687A probably damaging Het
Naip2 A T 13: 100,148,812 I1292N probably damaging Het
Nmral1 A G 16: 4,714,558 F130L probably damaging Het
Nos1 A G 5: 117,879,385 N271S probably benign Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Olfr106-ps A T 17: 37,394,771 N77I probably damaging Het
Olfr1509 T C 14: 52,451,214 I267T probably benign Het
Olfr169 A T 16: 19,566,513 Y123* probably null Het
Olfr800 T C 10: 129,660,316 V170A probably benign Het
Pkdcc C G 17: 83,215,861 C132W probably damaging Het
Plekhg6 G A 6: 125,373,181 L265F probably benign Het
Prkaa1 A G 15: 5,178,696 T473A probably benign Het
Prpf3 G A 3: 95,836,489 Q451* probably null Het
Ptprh T A 7: 4,597,997 D127V possibly damaging Het
Rab36 T C 10: 75,041,933 probably null Het
Rasa1 A T 13: 85,238,163 Y427* probably null Het
Rgs11 T C 17: 26,204,547 probably null Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc39a10 A C 1: 46,836,013 M43R probably benign Het
Slc40a1 T A 1: 45,912,313 Q228L probably benign Het
Slc45a1 A T 4: 150,638,539 L296Q probably benign Het
Stambpl1 A G 19: 34,236,291 T307A probably benign Het
Stt3a T C 9: 36,732,929 T705A possibly damaging Het
Tec G A 5: 72,823,637 probably benign Het
Trp63 A T 16: 25,865,262 T300S possibly damaging Het
Vmn1r235 A G 17: 21,262,361 H316R probably benign Het
Vmn2r1 A G 3: 64,104,653 H645R possibly damaging Het
Wdfy4 A G 14: 33,109,548 I907T possibly damaging Het
Zcchc10 A G 11: 53,327,324 T33A probably benign Het
Zfp318 T A 17: 46,399,634 V761D probably damaging Het
Zfp358 T C 8: 3,496,146 probably null Het
Zfp661 G A 2: 127,577,548 P224L probably damaging Het
Zfp937 T C 2: 150,236,786 M33T probably damaging Het
Zfp955a T C 17: 33,242,066 H364R probably damaging Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0077:Shank2 UTSW 7 144192467 missense possibly damaging 0.85
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2074:Shank2 UTSW 7 144409540 missense probably damaging 1.00
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3907:Shank2 UTSW 7 144409576 missense probably damaging 1.00
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4519:Shank2 UTSW 7 144410205 missense probably damaging 1.00
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5027:Shank2 UTSW 7 144259105 nonsense probably null
R5165:Shank2 UTSW 7 144409636 missense possibly damaging 0.62
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6024:Shank2 UTSW 7 144180031 missense probably benign 0.12
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R6983:Shank2 UTSW 7 144081848 missense possibly damaging 0.94
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
R7605:Shank2 UTSW 7 144091779 missense possibly damaging 0.64
R7909:Shank2 UTSW 7 144411394 missense probably damaging 1.00
R7990:Shank2 UTSW 7 144411394 missense probably damaging 1.00
R8118:Shank2 UTSW 7 144409875 missense probably benign 0.01
RF009:Shank2 UTSW 7 144411571 missense possibly damaging 0.81
Z1176:Shank2 UTSW 7 144128377 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACATCCCTCTGACTGGCATGG -3'
(R):5'- GGCTCGGAAGGCTAAAGACATC -3'

Sequencing Primer
(F):5'- CATGGTTGTCTGTATCACTGCCAG -3'
(R):5'- GGCTAAAGACATCTGAGAGTGTG -3'
Posted On2015-10-21