Mutagenetix > Incidental Mutation

Incidental Mutation 'R4689:Olfr169'

354795

Institutional Source

Beutler Lab

Gene Symbol

Olfr169

Ensembl Gene

ENSMUSG00000068535

Gene Name

olfactory receptor 169

Synonyms

GA_x54KRFPKG5P-16014972-16014031, MOR273-3P

MMRRC Submission

041940-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R4689 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19564889-19571809 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 19566513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 123 (Y123*)

Ref Sequence

ENSEMBL: ENSMUSP00000150528 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090062] [ENSMUST00000215040] [ENSMUST00000215476] [ENSMUST00000216070]

AlphaFold

Q7TS53

Predicted Effect

probably null
Transcript: ENSMUST00000090062
AA Change: Y123*

SMART Domains

Protein: ENSMUSP00000087516
Gene: ENSMUSG00000068535
AA Change: Y123*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	308	1.3e-45	PFAM
Pfam:7TM_GPCR_Srsx	35	303	2e-6	PFAM
Pfam:7tm_1	41	290	7.4e-29	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000215040
AA Change: Y123*

Predicted Effect

probably null
Transcript: ENSMUST00000215476
AA Change: Y123*

Predicted Effect

probably null
Transcript: ENSMUST00000216070
AA Change: Y123*

Meta Mutation Damage Score

0.9716

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	C	A	17: 46,324,070	V336L	probably benign	Het
Acbd4	T	C	11: 103,105,368	L165P	possibly damaging	Het
Adam10	T	C	9: 70,765,954	S456P	possibly damaging	Het
Adgre4	T	C	17: 55,802,096	F368L	probably damaging	Het
Ahcyl1	G	T	3: 107,665,518	Y528*	probably null	Het
Aldh3b3	G	A	19: 3,964,516	V84M	probably damaging	Het
Cdca8	C	T	4: 124,931,103	G78E	probably damaging	Het
Cry2	T	C	2: 92,424,554	D152G	probably benign	Het
Cyp2c67	T	C	19: 39,638,588	Y266C	probably benign	Het
Dkk4	T	C	8: 22,625,320	F62S	probably benign	Het
Dnah12	G	A	14: 26,706,839	V207I	probably benign	Het
Dthd1	T	C	5: 62,842,912	C526R	probably damaging	Het
Dubr	A	T	16: 50,732,503		noncoding transcript	Het
F5	T	C	1: 164,151,973		probably benign	Het
Flcn	A	C	11: 59,801,044	W260G	possibly damaging	Het
Fmnl1	G	A	11: 103,193,736		probably null	Het
Frem2	A	T	3: 53,547,635	D2173E	probably benign	Het
Fstl4	C	T	11: 53,068,650	Q173*	probably null	Het
Gfra3	G	A	18: 34,690,587	P381S	unknown	Het
Gm28308	C	A	6: 52,213,311		probably benign	Het
Gm8394	T	A	10: 85,314,201		noncoding transcript	Het
Gm8730	T	A	8: 102,865,747		noncoding transcript	Het
Gzmd	T	C	14: 56,131,226		probably null	Het
Hexb	A	G	13: 97,181,092	Y366H	probably damaging	Het
Hydin	A	T	8: 110,595,414	H4566L	probably benign	Het
Ifi213	G	A	1: 173,590,420	T142I	possibly damaging	Het
Kif13b	T	A	14: 64,773,064	C1271S	probably damaging	Het
Krtap9-5	G	T	11: 99,949,460	C329F	unknown	Het
Larp1	G	T	11: 58,041,613	G207W	probably damaging	Het
Lfng	A	G	5: 140,614,439	D368G	probably damaging	Het
Mbd5	G	A	2: 49,258,279	V834I	possibly damaging	Het
Mterf1b	T	A	5: 4,197,263	Y301*	probably null	Het
Myh7b	T	C	2: 155,630,514	I1305T	possibly damaging	Het
Myo16	T	C	8: 10,438,890	V687A	probably damaging	Het
Naip2	A	T	13: 100,148,812	I1292N	probably damaging	Het
Nmral1	A	G	16: 4,714,558	F130L	probably damaging	Het
Nos1	A	G	5: 117,879,385	N271S	probably benign	Het
Nrap	A	G	19: 56,386,026	S23P	probably damaging	Het
Olfr106-ps	A	T	17: 37,394,771	N77I	probably damaging	Het
Olfr1509	T	C	14: 52,451,214	I267T	probably benign	Het
Olfr800	T	C	10: 129,660,316	V170A	probably benign	Het
Pkdcc	C	G	17: 83,215,861	C132W	probably damaging	Het
Plekhg6	G	A	6: 125,373,181	L265F	probably benign	Het
Prkaa1	A	G	15: 5,178,696	T473A	probably benign	Het
Prpf3	G	A	3: 95,836,489	Q451*	probably null	Het
Ptprh	T	A	7: 4,597,997	D127V	possibly damaging	Het
Rab36	T	C	10: 75,041,933		probably null	Het
Rasa1	A	T	13: 85,238,163	Y427*	probably null	Het
Rgs11	T	C	17: 26,204,547		probably null	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Shank2	G	A	7: 144,420,605	V1087I	probably benign	Het
Slc39a10	A	C	1: 46,836,013	M43R	probably benign	Het
Slc40a1	T	A	1: 45,912,313	Q228L	probably benign	Het
Slc45a1	A	T	4: 150,638,539	L296Q	probably benign	Het
Stambpl1	A	G	19: 34,236,291	T307A	probably benign	Het
Stt3a	T	C	9: 36,732,929	T705A	possibly damaging	Het
Tec	G	A	5: 72,823,637		probably benign	Het
Trp63	A	T	16: 25,865,262	T300S	possibly damaging	Het
Vmn1r235	A	G	17: 21,262,361	H316R	probably benign	Het
Vmn2r1	A	G	3: 64,104,653	H645R	possibly damaging	Het
Wdfy4	A	G	14: 33,109,548	I907T	possibly damaging	Het
Zcchc10	A	G	11: 53,327,324	T33A	probably benign	Het
Zfp318	T	A	17: 46,399,634	V761D	probably damaging	Het
Zfp358	T	C	8: 3,496,146		probably null	Het
Zfp661	G	A	2: 127,577,548	P224L	probably damaging	Het
Zfp937	T	C	2: 150,236,786	M33T	probably damaging	Het
Zfp955a	T	C	17: 33,242,066	H364R	probably damaging	Het

Other mutations in Olfr169

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01080:Olfr169	APN	16	19566208	missense	probably damaging	1.00
IGL01862:Olfr169	APN	16	19566676	missense	probably damaging	1.00
IGL02064:Olfr169	APN	16	19566548	missense	probably damaging	1.00
IGL03061:Olfr169	APN	16	19566713	missense	possibly damaging	0.87
IGL03136:Olfr169	APN	16	19566353	missense	probably damaging	1.00
R0066:Olfr169	UTSW	16	19566049	missense	probably damaging	1.00
R0243:Olfr169	UTSW	16	19566294	missense	probably damaging	0.97
R0629:Olfr169	UTSW	16	19565980	missense	possibly damaging	0.88
R1644:Olfr169	UTSW	16	19566406	missense	probably benign	0.11
R1943:Olfr169	UTSW	16	19566437	missense	probably benign	0.19
R3016:Olfr169	UTSW	16	19566391	missense	probably damaging	1.00
R4290:Olfr169	UTSW	16	19566244	missense	possibly damaging	0.88
R4791:Olfr169	UTSW	16	19566663	missense	possibly damaging	0.50
R5497:Olfr169	UTSW	16	19566330	missense	probably benign	0.10
R5843:Olfr169	UTSW	16	19566583	missense	probably damaging	1.00
R6106:Olfr169	UTSW	16	19566259	missense	probably damaging	0.99
R6249:Olfr169	UTSW	16	19565975	missense	probably damaging	0.99
R7895:Olfr169	UTSW	16	19566722	nonsense	probably null
R9284:Olfr169	UTSW	16	19566607	missense	probably damaging	1.00
R9335:Olfr169	UTSW	16	19566763	missense	probably benign	0.32
R9364:Olfr169	UTSW	16	19565972	missense	possibly damaging	0.68
R9404:Olfr169	UTSW	16	19565981	missense	probably benign	0.01
R9475:Olfr169	UTSW	16	19566520	missense	probably benign	0.09
R9554:Olfr169	UTSW	16	19565972	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TCAACATGGCAGGGACTTCG -3'
(R):5'- AGGGATTCTCGACTCCATACCC -3'

Sequencing Primer
(F):5'- TCGCAGAAAAAGTGATCAATGGCTC -3'
(R):5'- GGATTCTCGACTCCATACCCCAATG -3'

Posted On

2015-10-21