Incidental Mutation 'R4689:Olfr169'
ID354795
Institutional Source Beutler Lab
Gene Symbol Olfr169
Ensembl Gene ENSMUSG00000068535
Gene Nameolfactory receptor 169
SynonymsGA_x54KRFPKG5P-16014972-16014031, MOR273-3P
MMRRC Submission 041940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4689 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19564889-19571809 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 19566513 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 123 (Y123*)
Ref Sequence ENSEMBL: ENSMUSP00000150528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090062] [ENSMUST00000215040] [ENSMUST00000215476] [ENSMUST00000216070]
Predicted Effect probably null
Transcript: ENSMUST00000090062
AA Change: Y123*
SMART Domains Protein: ENSMUSP00000087516
Gene: ENSMUSG00000068535
AA Change: Y123*

DomainStartEndE-ValueType
Pfam:7tm_4 28 308 1.3e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2e-6 PFAM
Pfam:7tm_1 41 290 7.4e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215040
AA Change: Y123*
Predicted Effect probably null
Transcript: ENSMUST00000215476
AA Change: Y123*
Predicted Effect probably null
Transcript: ENSMUST00000216070
AA Change: Y123*
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C A 17: 46,324,070 V336L probably benign Het
Acbd4 T C 11: 103,105,368 L165P possibly damaging Het
Adam10 T C 9: 70,765,954 S456P possibly damaging Het
Adgre4 T C 17: 55,802,096 F368L probably damaging Het
Ahcyl1 G T 3: 107,665,518 Y528* probably null Het
Aldh3b3 G A 19: 3,964,516 V84M probably damaging Het
Cdca8 C T 4: 124,931,103 G78E probably damaging Het
Cry2 T C 2: 92,424,554 D152G probably benign Het
Cyp2c67 T C 19: 39,638,588 Y266C probably benign Het
Dkk4 T C 8: 22,625,320 F62S probably benign Het
Dnah12 G A 14: 26,706,839 V207I probably benign Het
Dthd1 T C 5: 62,842,912 C526R probably damaging Het
Dubr A T 16: 50,732,503 noncoding transcript Het
F5 T C 1: 164,151,973 probably benign Het
Flcn A C 11: 59,801,044 W260G possibly damaging Het
Fmnl1 G A 11: 103,193,736 probably null Het
Frem2 A T 3: 53,547,635 D2173E probably benign Het
Fstl4 C T 11: 53,068,650 Q173* probably null Het
Gfra3 G A 18: 34,690,587 P381S unknown Het
Gm28308 C A 6: 52,213,311 probably benign Het
Gm8394 T A 10: 85,314,201 noncoding transcript Het
Gm8730 T A 8: 102,865,747 noncoding transcript Het
Gzmd T C 14: 56,131,226 probably null Het
Hexb A G 13: 97,181,092 Y366H probably damaging Het
Hydin A T 8: 110,595,414 H4566L probably benign Het
Ifi213 G A 1: 173,590,420 T142I possibly damaging Het
Kif13b T A 14: 64,773,064 C1271S probably damaging Het
Krtap9-5 G T 11: 99,949,460 C329F unknown Het
Larp1 G T 11: 58,041,613 G207W probably damaging Het
Lfng A G 5: 140,614,439 D368G probably damaging Het
Mbd5 G A 2: 49,258,279 V834I possibly damaging Het
Mterf1b T A 5: 4,197,263 Y301* probably null Het
Myh7b T C 2: 155,630,514 I1305T possibly damaging Het
Myo16 T C 8: 10,438,890 V687A probably damaging Het
Naip2 A T 13: 100,148,812 I1292N probably damaging Het
Nmral1 A G 16: 4,714,558 F130L probably damaging Het
Nos1 A G 5: 117,879,385 N271S probably benign Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Olfr106-ps A T 17: 37,394,771 N77I probably damaging Het
Olfr1509 T C 14: 52,451,214 I267T probably benign Het
Olfr800 T C 10: 129,660,316 V170A probably benign Het
Pkdcc C G 17: 83,215,861 C132W probably damaging Het
Plekhg6 G A 6: 125,373,181 L265F probably benign Het
Prkaa1 A G 15: 5,178,696 T473A probably benign Het
Prpf3 G A 3: 95,836,489 Q451* probably null Het
Ptprh T A 7: 4,597,997 D127V possibly damaging Het
Rab36 T C 10: 75,041,933 probably null Het
Rasa1 A T 13: 85,238,163 Y427* probably null Het
Rgs11 T C 17: 26,204,547 probably null Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Shank2 G A 7: 144,420,605 V1087I probably benign Het
Slc39a10 A C 1: 46,836,013 M43R probably benign Het
Slc40a1 T A 1: 45,912,313 Q228L probably benign Het
Slc45a1 A T 4: 150,638,539 L296Q probably benign Het
Stambpl1 A G 19: 34,236,291 T307A probably benign Het
Stt3a T C 9: 36,732,929 T705A possibly damaging Het
Tec G A 5: 72,823,637 probably benign Het
Trp63 A T 16: 25,865,262 T300S possibly damaging Het
Vmn1r235 A G 17: 21,262,361 H316R probably benign Het
Vmn2r1 A G 3: 64,104,653 H645R possibly damaging Het
Wdfy4 A G 14: 33,109,548 I907T possibly damaging Het
Zcchc10 A G 11: 53,327,324 T33A probably benign Het
Zfp318 T A 17: 46,399,634 V761D probably damaging Het
Zfp358 T C 8: 3,496,146 probably null Het
Zfp661 G A 2: 127,577,548 P224L probably damaging Het
Zfp937 T C 2: 150,236,786 M33T probably damaging Het
Zfp955a T C 17: 33,242,066 H364R probably damaging Het
Other mutations in Olfr169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Olfr169 APN 16 19566208 missense probably damaging 1.00
IGL01862:Olfr169 APN 16 19566676 missense probably damaging 1.00
IGL02064:Olfr169 APN 16 19566548 missense probably damaging 1.00
IGL03061:Olfr169 APN 16 19566713 missense possibly damaging 0.87
IGL03136:Olfr169 APN 16 19566353 missense probably damaging 1.00
R0066:Olfr169 UTSW 16 19566049 missense probably damaging 1.00
R0243:Olfr169 UTSW 16 19566294 missense probably damaging 0.97
R0629:Olfr169 UTSW 16 19565980 missense possibly damaging 0.88
R1644:Olfr169 UTSW 16 19566406 missense probably benign 0.11
R1943:Olfr169 UTSW 16 19566437 missense probably benign 0.19
R3016:Olfr169 UTSW 16 19566391 missense probably damaging 1.00
R4290:Olfr169 UTSW 16 19566244 missense possibly damaging 0.88
R4791:Olfr169 UTSW 16 19566663 missense possibly damaging 0.50
R5497:Olfr169 UTSW 16 19566330 missense probably benign 0.10
R5843:Olfr169 UTSW 16 19566583 missense probably damaging 1.00
R6106:Olfr169 UTSW 16 19566259 missense probably damaging 0.99
R6249:Olfr169 UTSW 16 19565975 missense probably damaging 0.99
R7895:Olfr169 UTSW 16 19566722 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAACATGGCAGGGACTTCG -3'
(R):5'- AGGGATTCTCGACTCCATACCC -3'

Sequencing Primer
(F):5'- TCGCAGAAAAAGTGATCAATGGCTC -3'
(R):5'- GGATTCTCGACTCCATACCCCAATG -3'
Posted On2015-10-21