Incidental Mutation 'R4689:Trp63'
ID354796
Institutional Source Beutler Lab
Gene Symbol Trp63
Ensembl Gene ENSMUSG00000022510
Gene Nametransformation related protein 63
SynonymsTAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1
MMRRC Submission 041940-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R4689 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location25683763-25892102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25865262 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 300 (T300S)
Ref Sequence ENSEMBL: ENSMUSP00000110965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115304] [ENSMUST00000115305] [ENSMUST00000115306] [ENSMUST00000115308] [ENSMUST00000115310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040231
AA Change: T206S

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: T206S

DomainStartEndE-ValueType
Pfam:P53 69 265 5.4e-110 PFAM
Pfam:P53_tetramer 297 338 2.4e-20 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
SAM 447 513 1.4e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065523
AA Change: T300S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510
AA Change: T300S

DomainStartEndE-ValueType
Pfam:P53 163 359 4.9e-110 PFAM
Pfam:P53_tetramer 391 432 2.2e-20 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115304
AA Change: T206S

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110959
Gene: ENSMUSG00000022510
AA Change: T206S

DomainStartEndE-ValueType
Pfam:P53 69 265 1.5e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115305
AA Change: T206S

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110960
Gene: ENSMUSG00000022510
AA Change: T206S

DomainStartEndE-ValueType
Pfam:P53 69 265 1.1e-110 PFAM
Pfam:P53_tetramer 297 338 5.5e-21 PFAM
low complexity region 343 358 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115306
AA Change: T206S

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: T206S

DomainStartEndE-ValueType
Pfam:P53 69 265 2.7e-110 PFAM
Pfam:P53_tetramer 293 334 9.2e-21 PFAM
low complexity region 339 352 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
SAM 443 509 1.4e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115308
AA Change: T300S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510
AA Change: T300S

DomainStartEndE-ValueType
Pfam:P53 163 359 3.6e-110 PFAM
Pfam:P53_tetramer 387 428 1.8e-20 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115310
AA Change: T300S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: T300S

DomainStartEndE-ValueType
Pfam:P53 163 359 1.3e-112 PFAM
Pfam:P53_tetramer 391 431 7e-21 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
SAM 541 607 1.4e-7 SMART
Meta Mutation Damage Score 0.7916 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C A 17: 46,324,070 V336L probably benign Het
Acbd4 T C 11: 103,105,368 L165P possibly damaging Het
Adam10 T C 9: 70,765,954 S456P possibly damaging Het
Adgre4 T C 17: 55,802,096 F368L probably damaging Het
Ahcyl1 G T 3: 107,665,518 Y528* probably null Het
Aldh3b3 G A 19: 3,964,516 V84M probably damaging Het
Cdca8 C T 4: 124,931,103 G78E probably damaging Het
Cry2 T C 2: 92,424,554 D152G probably benign Het
Cyp2c67 T C 19: 39,638,588 Y266C probably benign Het
Dkk4 T C 8: 22,625,320 F62S probably benign Het
Dnah12 G A 14: 26,706,839 V207I probably benign Het
Dthd1 T C 5: 62,842,912 C526R probably damaging Het
Dubr A T 16: 50,732,503 noncoding transcript Het
F5 T C 1: 164,151,973 probably benign Het
Flcn A C 11: 59,801,044 W260G possibly damaging Het
Fmnl1 G A 11: 103,193,736 probably null Het
Frem2 A T 3: 53,547,635 D2173E probably benign Het
Fstl4 C T 11: 53,068,650 Q173* probably null Het
Gfra3 G A 18: 34,690,587 P381S unknown Het
Gm28308 C A 6: 52,213,311 probably benign Het
Gm8394 T A 10: 85,314,201 noncoding transcript Het
Gm8730 T A 8: 102,865,747 noncoding transcript Het
Gzmd T C 14: 56,131,226 probably null Het
Hexb A G 13: 97,181,092 Y366H probably damaging Het
Hydin A T 8: 110,595,414 H4566L probably benign Het
Ifi213 G A 1: 173,590,420 T142I possibly damaging Het
Kif13b T A 14: 64,773,064 C1271S probably damaging Het
Krtap9-5 G T 11: 99,949,460 C329F unknown Het
Larp1 G T 11: 58,041,613 G207W probably damaging Het
Lfng A G 5: 140,614,439 D368G probably damaging Het
Mbd5 G A 2: 49,258,279 V834I possibly damaging Het
Mterf1b T A 5: 4,197,263 Y301* probably null Het
Myh7b T C 2: 155,630,514 I1305T possibly damaging Het
Myo16 T C 8: 10,438,890 V687A probably damaging Het
Naip2 A T 13: 100,148,812 I1292N probably damaging Het
Nmral1 A G 16: 4,714,558 F130L probably damaging Het
Nos1 A G 5: 117,879,385 N271S probably benign Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Olfr106-ps A T 17: 37,394,771 N77I probably damaging Het
Olfr1509 T C 14: 52,451,214 I267T probably benign Het
Olfr169 A T 16: 19,566,513 Y123* probably null Het
Olfr800 T C 10: 129,660,316 V170A probably benign Het
Pkdcc C G 17: 83,215,861 C132W probably damaging Het
Plekhg6 G A 6: 125,373,181 L265F probably benign Het
Prkaa1 A G 15: 5,178,696 T473A probably benign Het
Prpf3 G A 3: 95,836,489 Q451* probably null Het
Ptprh T A 7: 4,597,997 D127V possibly damaging Het
Rab36 T C 10: 75,041,933 probably null Het
Rasa1 A T 13: 85,238,163 Y427* probably null Het
Rgs11 T C 17: 26,204,547 probably null Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Shank2 G A 7: 144,420,605 V1087I probably benign Het
Slc39a10 A C 1: 46,836,013 M43R probably benign Het
Slc40a1 T A 1: 45,912,313 Q228L probably benign Het
Slc45a1 A T 4: 150,638,539 L296Q probably benign Het
Stambpl1 A G 19: 34,236,291 T307A probably benign Het
Stt3a T C 9: 36,732,929 T705A possibly damaging Het
Tec G A 5: 72,823,637 probably benign Het
Vmn1r235 A G 17: 21,262,361 H316R probably benign Het
Vmn2r1 A G 3: 64,104,653 H645R possibly damaging Het
Wdfy4 A G 14: 33,109,548 I907T possibly damaging Het
Zcchc10 A G 11: 53,327,324 T33A probably benign Het
Zfp318 T A 17: 46,399,634 V761D probably damaging Het
Zfp358 T C 8: 3,496,146 probably null Het
Zfp661 G A 2: 127,577,548 P224L probably damaging Het
Zfp937 T C 2: 150,236,786 M33T probably damaging Het
Zfp955a T C 17: 33,242,066 H364R probably damaging Het
Other mutations in Trp63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Trp63 APN 16 25871076 missense probably damaging 1.00
IGL01402:Trp63 APN 16 25820385 splice site probably benign
IGL01404:Trp63 APN 16 25820385 splice site probably benign
IGL01874:Trp63 APN 16 25882585 missense possibly damaging 0.88
IGL01887:Trp63 APN 16 25865319 missense probably damaging 1.00
IGL02008:Trp63 APN 16 25862461 missense probably damaging 1.00
IGL02336:Trp63 APN 16 25820442 missense probably damaging 1.00
IGL02470:Trp63 APN 16 25820384 splice site probably benign
IGL02720:Trp63 APN 16 25863741 missense probably damaging 0.96
IGL03230:Trp63 APN 16 25889010 missense probably damaging 1.00
PIT4142001:Trp63 UTSW 16 25865263 missense probably damaging 1.00
R0086:Trp63 UTSW 16 25871087 missense probably damaging 1.00
R0281:Trp63 UTSW 16 25764302 splice site probably benign
R1448:Trp63 UTSW 16 25889120 missense possibly damaging 0.67
R1517:Trp63 UTSW 16 25889253 missense probably damaging 1.00
R1539:Trp63 UTSW 16 25884849 missense probably benign 0.02
R3922:Trp63 UTSW 16 25889009 missense probably damaging 1.00
R3977:Trp63 UTSW 16 25820740 intron probably benign
R3978:Trp63 UTSW 16 25820740 intron probably benign
R3979:Trp63 UTSW 16 25820740 intron probably benign
R4870:Trp63 UTSW 16 25866218 makesense probably null
R5009:Trp63 UTSW 16 25868227 missense probably damaging 0.99
R5033:Trp63 UTSW 16 25763306 missense probably damaging 0.99
R5058:Trp63 UTSW 16 25882594 missense probably damaging 1.00
R5118:Trp63 UTSW 16 25889010 missense unknown
R5354:Trp63 UTSW 16 25684355 splice site probably null
R5363:Trp63 UTSW 16 25863718 missense probably damaging 0.99
R5668:Trp63 UTSW 16 25866185 missense possibly damaging 0.52
R6004:Trp63 UTSW 16 25763396 critical splice donor site probably null
R6029:Trp63 UTSW 16 25868214 missense probably damaging 1.00
R6170:Trp63 UTSW 16 25884853 missense probably benign 0.28
R6186:Trp63 UTSW 16 25876733 intron probably benign
R6266:Trp63 UTSW 16 25862460 missense probably damaging 0.99
R6466:Trp63 UTSW 16 25763358 missense probably damaging 1.00
R6486:Trp63 UTSW 16 25865340 missense probably damaging 0.99
R6913:Trp63 UTSW 16 25889168 missense probably damaging 1.00
R6980:Trp63 UTSW 16 25802093 missense probably benign
R7097:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7122:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7544:Trp63 UTSW 16 25802087 missense probably benign
R7690:Trp63 UTSW 16 25876733 missense unknown
R7743:Trp63 UTSW 16 25882625 missense probably benign 0.05
R7766:Trp63 UTSW 16 25868219 missense probably damaging 0.97
R7792:Trp63 UTSW 16 25868224 missense possibly damaging 0.94
R7816:Trp63 UTSW 16 25889240 missense probably damaging 1.00
Z1088:Trp63 UTSW 16 25763313 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGACTGTGAGAGCTCTCCAG -3'
(R):5'- CTCTTTCTAAAGGCAAAGGCAG -3'

Sequencing Primer
(F):5'- AGAGCTCTCCAGGGGATTTTAC -3'
(R):5'- CAAAGAATTCTGCTTGGTCC -3'
Posted On2015-10-21