Mutagenetix > Incidental Mutations

Incidental Mutation 'R4690:Serpinb13'

354811

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

041941-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R4690 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106982844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 66 (S66L)

Ref Sequence

ENSEMBL: ENSMUSP00000118572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027564
AA Change: S66L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: S66L

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000136766
AA Change: S66L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: S66L

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,148,880	F436L	probably damaging	Het
Adam28	G	T	14: 68,642,048	Q184K	probably benign	Het
Adh6a	A	G	3: 138,326,171	T275A	possibly damaging	Het
Agap2	A	G	10: 127,091,375	D1082G	possibly damaging	Het
Alox5	A	T	6: 116,423,189	V263E	probably damaging	Het
Arhgef16	C	T	4: 154,287,963		probably null	Het
Bspry	G	A	4: 62,486,525	R186Q	probably damaging	Het
Ccdc188	T	A	16: 18,218,295	H111Q	probably damaging	Het
Cd40	T	C	2: 165,069,695	F209S	possibly damaging	Het
Cfap43	C	A	19: 47,747,859	V1398L	probably benign	Het
Cln3	A	T	7: 126,575,393	I286N	possibly damaging	Het
Col9a1	T	C	1: 24,224,706		probably null	Het
Cpne9	A	G	6: 113,302,055	E470G	probably damaging	Het
Cul5	A	T	9: 53,622,871	W654R	probably damaging	Het
Cyp2a22	T	A	7: 26,939,209	K51*	probably null	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Dot1l	C	A	10: 80,786,182	S556*	probably null	Het
Eif3d	A	T	15: 77,967,316	M98K	probably benign	Het
Fam205c	T	A	4: 42,873,032		probably null	Het
Fiz1	A	G	7: 5,009,168	V117A	probably benign	Het
Fryl	A	G	5: 73,100,293	V722A	probably benign	Het
Gm3095	G	T	14: 3,964,471	R63I	probably benign	Het
Gm7133	A	T	1: 97,269,499		noncoding transcript	Het
Gm813	G	A	16: 58,613,970	T128I	probably benign	Het
Hoxb8	A	T	11: 96,284,460	D241V	probably benign	Het
Hrnr	A	G	3: 93,323,652	Q399R	unknown	Het
Itpk1	A	T	12: 102,606,175	V93D	probably damaging	Het
Kars	C	T	8: 112,002,584	A164T	probably benign	Het
Kcnq4	A	T	4: 120,717,011	I150N	probably damaging	Het
Kcnrg	A	T	14: 61,611,727	L212F	probably damaging	Het
Kif5b	A	T	18: 6,216,759	D521E	probably benign	Het
Klf11	C	T	12: 24,655,072	T158M	probably damaging	Het
Klhl6	T	C	16: 19,957,284	I175V	probably benign	Het
Lsm1	A	G	8: 25,793,680	N40S	probably damaging	Het
Map1b	T	C	13: 99,431,068	E1715G	unknown	Het
Mecom	C	A	3: 30,238,310	A4S	probably benign	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Mug2	A	T	6: 122,036,296	I341L	probably benign	Het
Mxra7	A	T	11: 116,816,252		probably null	Het
Myo5a	T	C	9: 75,153,823	L537P	probably damaging	Het
Myo5b	A	T	18: 74,722,462	N1241Y	probably damaging	Het
Naa16	T	C	14: 79,345,057	R531G	probably damaging	Het
Neb	T	A	2: 52,244,075	M3299L	probably benign	Het
Nlrp4b	T	A	7: 10,719,203	Y76N	probably benign	Het
Nmral1	T	C	16: 4,716,341	T79A	probably damaging	Het
Noct	C	T	3: 51,247,879	Q23*	probably null	Het
Nrxn1	A	T	17: 90,037,081	V438D	probably damaging	Het
Olfr1034	T	A	2: 86,046,898	C139S	probably damaging	Het
Olfr1463	A	C	19: 13,234,768	N173H	possibly damaging	Het
Oxct2a	T	C	4: 123,323,043	T182A	probably benign	Het
Pank2	T	C	2: 131,274,025	I121T	probably damaging	Het
Pcdh1	T	A	18: 38,203,475	T36S	probably benign	Het
Pfdn1	A	T	18: 36,451,080	M67K	possibly damaging	Het
Plec	T	C	15: 76,174,256	E3849G	probably damaging	Het
Polr3a	A	T	14: 24,464,281	S817T	possibly damaging	Het
Pomgnt1	T	A	4: 116,155,510	D401E	probably damaging	Het
Ppp1r13b	T	A	12: 111,832,558	D891V	probably damaging	Het
Prr14l	A	G	5: 32,844,156		probably benign	Het
Ptk2b	A	G	14: 66,173,300		probably null	Het
Rab13	G	C	3: 90,221,023		probably null	Het
Rexo1	C	T	10: 80,546,421	A751T	probably benign	Het
Rfx1	T	C	8: 84,082,745	V233A	possibly damaging	Het
Rnf149	C	T	1: 39,577,214		probably benign	Het
Rrm1	A	G	7: 102,447,879	D122G	probably benign	Het
Serpina1b	A	G	12: 103,732,380	F70S	probably damaging	Het
Sh3rf3	T	C	10: 58,813,704	S44P	possibly damaging	Het
Shroom1	A	G	11: 53,465,722	T471A	possibly damaging	Het
Slc6a1	A	G	6: 114,302,831	Y152C	probably damaging	Het
Spata6	A	T	4: 111,774,826	T145S	probably damaging	Het
Srcap	G	A	7: 127,538,014	G956D	probably damaging	Het
Ssh2	A	T	11: 77,455,205	I1339F	possibly damaging	Het
Tardbp	A	T	4: 148,612,621	*99K	probably null	Het
Tbc1d22a	A	G	15: 86,311,836	Y336C	probably damaging	Het
Tmcc3	G	A	10: 94,545,557		probably benign	Het
Tmem178b	T	G	6: 40,245,613	D87E	probably benign	Het
Tmem184a	A	C	5: 139,805,622	S380A	probably benign	Het
Tnfaip2	A	G	12: 111,445,248	K84R	possibly damaging	Het
Tpgs1	A	G	10: 79,675,401	T126A	probably benign	Het
Traf3ip1	A	G	1: 91,520,112	E437G	possibly damaging	Het
Trpc4ap	C	T	2: 155,635,133	C755Y	probably damaging	Het
Tsfm	A	G	10: 127,030,678		probably benign	Het
Tulp1	A	C	17: 28,351,837		probably benign	Het
Vmn1r23	A	T	6: 57,926,025	M256K	probably benign	Het
Zdhhc8	T	C	16: 18,226,741	D305G	probably damaging	Het
Zfp326	G	A	5: 105,907,076	R282H	probably damaging	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GGGCAACATAGACATTTCTCTGG -3'
(R):5'- AATCCAGGAGCTTTTGAGCAAG -3'

Sequencing Primer
(F):5'- AGACATTTCTCTGGCTTTTCAAGGAG -3'
(R):5'- AGCCTCTAGGACTTTGTTATAGCAGC -3'

Posted On

2015-10-21