Incidental Mutation 'R4690:Pank2'
ID354815
Institutional Source Beutler Lab
Gene Symbol Pank2
Ensembl Gene ENSMUSG00000037514
Gene Namepantothenate kinase 2
Synonyms4933409I19Rik
MMRRC Submission 041941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4690 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131262495-131299188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131274025 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 121 (I121T)
Ref Sequence ENSEMBL: ENSMUSP00000139259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000150843] [ENSMUST00000184105] [ENSMUST00000184932]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138509
Predicted Effect unknown
Transcript: ENSMUST00000145904
AA Change: I45T
SMART Domains Protein: ENSMUSP00000115034
Gene: ENSMUSG00000037514
AA Change: I45T

DomainStartEndE-ValueType
Pfam:Fumble 11 128 5.1e-21 PFAM
Pfam:Fumble 121 178 2.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150843
AA Change: I121T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119606
Gene: ENSMUSG00000037514
AA Change: I121T

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 86 438 8.8e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183349
Predicted Effect probably benign
Transcript: ENSMUST00000183388
Predicted Effect probably damaging
Transcript: ENSMUST00000184105
AA Change: I121T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138992
Gene: ENSMUSG00000037514
AA Change: I121T

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 154 7.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184932
AA Change: I121T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139259
Gene: ENSMUSG00000037514
AA Change: I121T

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 151 1e-12 PFAM
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrested spermatogenesis, azoospermia, reduced female fertility, and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,148,880 F436L probably damaging Het
Adam28 G T 14: 68,642,048 Q184K probably benign Het
Adh6a A G 3: 138,326,171 T275A possibly damaging Het
Agap2 A G 10: 127,091,375 D1082G possibly damaging Het
Alox5 A T 6: 116,423,189 V263E probably damaging Het
Arhgef16 C T 4: 154,287,963 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Ccdc188 T A 16: 18,218,295 H111Q probably damaging Het
Cd40 T C 2: 165,069,695 F209S possibly damaging Het
Cfap43 C A 19: 47,747,859 V1398L probably benign Het
Cln3 A T 7: 126,575,393 I286N possibly damaging Het
Col9a1 T C 1: 24,224,706 probably null Het
Cpne9 A G 6: 113,302,055 E470G probably damaging Het
Cul5 A T 9: 53,622,871 W654R probably damaging Het
Cyp2a22 T A 7: 26,939,209 K51* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dot1l C A 10: 80,786,182 S556* probably null Het
Eif3d A T 15: 77,967,316 M98K probably benign Het
Fam205c T A 4: 42,873,032 probably null Het
Fiz1 A G 7: 5,009,168 V117A probably benign Het
Fryl A G 5: 73,100,293 V722A probably benign Het
Gm3095 G T 14: 3,964,471 R63I probably benign Het
Gm7133 A T 1: 97,269,499 noncoding transcript Het
Gm813 G A 16: 58,613,970 T128I probably benign Het
Hoxb8 A T 11: 96,284,460 D241V probably benign Het
Hrnr A G 3: 93,323,652 Q399R unknown Het
Itpk1 A T 12: 102,606,175 V93D probably damaging Het
Kars C T 8: 112,002,584 A164T probably benign Het
Kcnq4 A T 4: 120,717,011 I150N probably damaging Het
Kcnrg A T 14: 61,611,727 L212F probably damaging Het
Kif5b A T 18: 6,216,759 D521E probably benign Het
Klf11 C T 12: 24,655,072 T158M probably damaging Het
Klhl6 T C 16: 19,957,284 I175V probably benign Het
Lsm1 A G 8: 25,793,680 N40S probably damaging Het
Map1b T C 13: 99,431,068 E1715G unknown Het
Mecom C A 3: 30,238,310 A4S probably benign Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Mug2 A T 6: 122,036,296 I341L probably benign Het
Mxra7 A T 11: 116,816,252 probably null Het
Myo5a T C 9: 75,153,823 L537P probably damaging Het
Myo5b A T 18: 74,722,462 N1241Y probably damaging Het
Naa16 T C 14: 79,345,057 R531G probably damaging Het
Neb T A 2: 52,244,075 M3299L probably benign Het
Nlrp4b T A 7: 10,719,203 Y76N probably benign Het
Nmral1 T C 16: 4,716,341 T79A probably damaging Het
Noct C T 3: 51,247,879 Q23* probably null Het
Nrxn1 A T 17: 90,037,081 V438D probably damaging Het
Olfr1034 T A 2: 86,046,898 C139S probably damaging Het
Olfr1463 A C 19: 13,234,768 N173H possibly damaging Het
Oxct2a T C 4: 123,323,043 T182A probably benign Het
Pcdh1 T A 18: 38,203,475 T36S probably benign Het
Pfdn1 A T 18: 36,451,080 M67K possibly damaging Het
Plec T C 15: 76,174,256 E3849G probably damaging Het
Polr3a A T 14: 24,464,281 S817T possibly damaging Het
Pomgnt1 T A 4: 116,155,510 D401E probably damaging Het
Ppp1r13b T A 12: 111,832,558 D891V probably damaging Het
Prr14l A G 5: 32,844,156 probably benign Het
Ptk2b A G 14: 66,173,300 probably null Het
Rab13 G C 3: 90,221,023 probably null Het
Rexo1 C T 10: 80,546,421 A751T probably benign Het
Rfx1 T C 8: 84,082,745 V233A possibly damaging Het
Rnf149 C T 1: 39,577,214 probably benign Het
Rrm1 A G 7: 102,447,879 D122G probably benign Het
Serpina1b A G 12: 103,732,380 F70S probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh3rf3 T C 10: 58,813,704 S44P possibly damaging Het
Shroom1 A G 11: 53,465,722 T471A possibly damaging Het
Slc6a1 A G 6: 114,302,831 Y152C probably damaging Het
Spata6 A T 4: 111,774,826 T145S probably damaging Het
Srcap G A 7: 127,538,014 G956D probably damaging Het
Ssh2 A T 11: 77,455,205 I1339F possibly damaging Het
Tardbp A T 4: 148,612,621 *99K probably null Het
Tbc1d22a A G 15: 86,311,836 Y336C probably damaging Het
Tmcc3 G A 10: 94,545,557 probably benign Het
Tmem178b T G 6: 40,245,613 D87E probably benign Het
Tmem184a A C 5: 139,805,622 S380A probably benign Het
Tnfaip2 A G 12: 111,445,248 K84R possibly damaging Het
Tpgs1 A G 10: 79,675,401 T126A probably benign Het
Traf3ip1 A G 1: 91,520,112 E437G possibly damaging Het
Trpc4ap C T 2: 155,635,133 C755Y probably damaging Het
Tsfm A G 10: 127,030,678 probably benign Het
Tulp1 A C 17: 28,351,837 probably benign Het
Vmn1r23 A T 6: 57,926,025 M256K probably benign Het
Zdhhc8 T C 16: 18,226,741 D305G probably damaging Het
Zfp326 G A 5: 105,907,076 R282H probably damaging Het
Other mutations in Pank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pank2 APN 2 131274169 missense possibly damaging 0.69
R0242:Pank2 UTSW 2 131280197 missense probably damaging 1.00
R0242:Pank2 UTSW 2 131280197 missense probably damaging 1.00
R0492:Pank2 UTSW 2 131280260 missense probably damaging 1.00
R0513:Pank2 UTSW 2 131282606 missense probably damaging 1.00
R1415:Pank2 UTSW 2 131282718 nonsense probably null
R1622:Pank2 UTSW 2 131273969 missense probably damaging 1.00
R2217:Pank2 UTSW 2 131282681 intron probably null
R4691:Pank2 UTSW 2 131296281 missense possibly damaging 0.85
R5387:Pank2 UTSW 2 131274262 missense probably benign 0.24
R6175:Pank2 UTSW 2 131280261 nonsense probably null
R6806:Pank2 UTSW 2 131262707 unclassified probably benign
R6848:Pank2 UTSW 2 131282626 missense probably damaging 0.98
R7010:Pank2 UTSW 2 131280373 missense probably benign
R7467:Pank2 UTSW 2 131274047 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCATATGGAATAAGTTGCCAGTC -3'
(R):5'- TCCAGTGGCACAAAAGACAG -3'

Sequencing Primer
(F):5'- AGTTGCCAGTCAAGTAAATATAAGC -3'
(R):5'- GTGGAGACTTGAGAAGTTTTTATCTC -3'
Posted On2015-10-21