Incidental Mutation 'R0206:Tnfrsf21'
ID35486
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 038459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0206 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43038213 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 239 (H239Y)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,282,662 C5R probably damaging Het
4930430F08Rik T A 10: 100,586,194 K69* probably null Het
A530064D06Rik G A 17: 48,163,318 T165I probably benign Het
A830010M20Rik A G 5: 107,505,040 T304A probably benign Het
Acsl5 A G 19: 55,280,569 K221E probably benign Het
Adam26a A C 8: 43,570,418 F12V possibly damaging Het
Adgrb2 T C 4: 129,992,559 L164P probably damaging Het
Aldh1l1 T C 6: 90,569,866 F384L possibly damaging Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdca3 C T 6: 124,832,551 probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Cit A T 5: 115,994,030 N1782Y possibly damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Csgalnact2 T G 6: 118,114,386 Q197P probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Ddt A G 10: 75,772,885 M1T probably null Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Gabra6 C T 11: 42,317,079 W188* probably null Het
Gnptab A T 10: 88,439,510 H1111L probably damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Inpp5k T C 11: 75,631,143 I15T probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Kctd8 A T 5: 69,341,165 V46E probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Me3 A T 7: 89,849,660 T483S probably benign Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mvk C T 5: 114,458,974 T334M probably damaging Het
Mxra8 T A 4: 155,842,596 I329N probably damaging Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Myom1 T C 17: 71,037,297 S266P probably damaging Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr308 T C 7: 86,321,646 Y102C probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Olfr690 A T 7: 105,329,883 M103K possibly damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Pomgnt1 T C 4: 116,158,560 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rmdn2 T A 17: 79,650,287 probably benign Het
Ryr2 A G 13: 11,676,251 probably benign Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Slc1a3 A G 15: 8,708,556 probably benign Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Snx33 G A 9: 56,926,224 S187L probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tinag A G 9: 76,999,852 I367T probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Ube4b T C 4: 149,398,637 H58R probably benign Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Usp28 A G 9: 49,028,269 Y275C probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Vps13c A G 9: 67,939,162 probably benign Het
Vwf T C 6: 125,637,456 F1100S probably damaging Het
Zfp318 G T 17: 46,399,019 R556L probably benign Het
Zkscan1 T A 5: 138,101,186 C391S probably damaging Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
palmer_park UTSW 17 43038010 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAAAGCTCACACGGACTGTCTGG -3'
(R):5'- GCTCCATCTACACACGATTAGCTCC -3'

Sequencing Primer
(F):5'- GGACTGTCTGGGTCAGAAC -3'
(R):5'- acaactaaaatcactcaactcactc -3'
Posted On2013-05-09