Mutagenetix > Incidental Mutations

Incidental Mutation 'R4691:Stra6l'

354897

Institutional Source

Beutler Lab

Gene Symbol

Stra6l

Ensembl Gene

ENSMUSG00000028327

Gene Name

STRA6-like

Synonyms

Rbpr2, 1300002K09Rik

MMRRC Submission

041942-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4691 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45848664-45887008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 45882851 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 521 (A521T)

Ref Sequence

ENSEMBL: ENSMUSP00000103412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030011] [ENSMUST00000107782] [ENSMUST00000107783]

Predicted Effect

probably benign
Transcript: ENSMUST00000030011
AA Change: A521T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000030011
Gene: ENSMUSG00000028327
AA Change: A521T

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	13	602	8.7e-228	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107782
AA Change: A430T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103411
Gene: ENSMUSG00000028327
AA Change: A430T

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	1	512	2.8e-221	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107783
AA Change: A521T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103412
Gene: ENSMUSG00000028327
AA Change: A521T

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	12	603	1e-254	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165478

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (70/72)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca13	A	T	11: 9,434,195	R3882S	probably damaging	Het
Adamts2	G	T	11: 50,756,696	V299F	probably damaging	Het
Ankrd50	A	G	3: 38,483,010	S65P	probably benign	Het
Ap4e1	T	C	2: 127,061,871	C898R	probably benign	Het
Arel1	A	T	12: 84,930,249		probably null	Het
Bag6	T	A	17: 35,139,248	V164D	probably damaging	Het
C2cd5	A	G	6: 143,030,148	S769P	possibly damaging	Het
Cables1	C	T	18: 11,840,523	Q240*	probably null	Het
Ccnb1-ps	T	A	7: 42,106,092		noncoding transcript	Het
Ccz1	A	T	5: 143,991,562	I390N	possibly damaging	Het
Ces1a	T	C	8: 93,032,659	H283R	probably benign	Het
Clca3b	G	A	3: 144,839,092	T378I	probably benign	Het
Cpne2	A	T	8: 94,558,221	I342F	probably damaging	Het
Cyp2d9	A	G	15: 82,455,832	D141G	probably damaging	Het
Ddias	T	A	7: 92,858,816	K630N	probably damaging	Het
Dennd4b	A	G	3: 90,272,312	T626A	probably damaging	Het
Disc1	T	C	8: 125,148,447	V554A	possibly damaging	Het
Dnah10	A	G	5: 124,775,517	T1880A	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epop	C	T	11: 97,628,893	G130D	possibly damaging	Het
Erap1	T	C	13: 74,673,692	L722P	probably damaging	Het
Eya4	T	A	10: 23,140,068	T334S	probably benign	Het
Ezr	T	C	17: 6,759,562	I5V	probably benign	Het
Fam53c	A	C	18: 34,768,690	E220A	probably damaging	Het
Galnt12	T	C	4: 47,104,143	S134P	probably damaging	Het
Gcfc2	T	A	6: 81,941,427	L366*	probably null	Het
Gins4	T	A	8: 23,237,059	D6V	probably benign	Het
Gm1113	T	C	9: 35,516,862	S106G	possibly damaging	Het
Gm5155	T	A	7: 17,908,966	S434T	possibly damaging	Het
Grid1	A	G	14: 35,569,557	H807R	probably benign	Het
H2-T22	GTTTT	GTTT	17: 36,041,570		probably null	Het
Ighv1-66	T	C	12: 115,593,309	Y51C	probably benign	Het
Inpp4b	A	T	8: 82,122,653	Y901F	probably damaging	Het
Irf2	T	A	8: 46,846,187	S339T	probably damaging	Het
Itgae	G	T	11: 73,119,519	G612*	probably null	Het
Kdr	T	C	5: 75,944,599	K1037R	possibly damaging	Het
Mro	A	T	18: 73,873,326	M115L	probably benign	Het
Myo5a	A	G	9: 75,180,156	E1098G	probably damaging	Het
Nkx2-1	T	A	12: 56,533,565	M197L	probably benign	Het
Olfr58	T	C	9: 19,783,382	I83T	probably benign	Het
Pank2	T	A	2: 131,296,281	F430L	possibly damaging	Het
Pcx	T	A	19: 4,619,477	V794E	probably damaging	Het
Pdgfd	C	T	9: 6,288,556	P70L	probably damaging	Het
Pla2g4e	T	C	2: 120,174,300	Y521C	probably damaging	Het
Pou5f1	T	A	17: 35,506,131	F11Y	probably damaging	Het
Prdm9	A	G	17: 15,553,378	M252T	probably benign	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Rad51ap1	A	G	6: 126,927,553	S123P	probably benign	Het
Robo3	T	C	9: 37,425,218	E418G	probably damaging	Het
Sos2	C	T	12: 69,616,328	R631H	probably damaging	Het
St3gal2	C	T	8: 110,957,785	T25I	probably benign	Het
Syt7	T	A	19: 10,426,481	L177Q	probably damaging	Het
Tet2	T	A	3: 133,486,083	Q863H	possibly damaging	Het
Tmem232	T	C	17: 65,265,242	K585E	possibly damaging	Het
Trpc6	A	C	9: 8,652,978	E595A	probably damaging	Het
Txnl1	A	G	18: 63,671,679	V248A	possibly damaging	Het
Vmn2r72	A	T	7: 85,737,911	L815*	probably null	Het
Vmn2r81	C	T	10: 79,293,377	Q701*	probably null	Het
Vps13c	T	C	9: 67,952,935	V2811A	possibly damaging	Het
Zfp354a	A	G	11: 51,070,237	E425G	probably damaging	Het
Zfp617	A	T	8: 71,932,815	T330S	probably benign	Het
Zfp663	G	T	2: 165,359,130		probably benign	Het
Zfp84	T	C	7: 29,777,080	L399P	probably damaging	Het
Zfp869	A	T	8: 69,706,863	C353*	probably null	Het
Zscan22	C	T	7: 12,906,561	A85V	probably benign	Het

Other mutations in Stra6l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Stra6l	APN	4	45864864	splice site	probably null
IGL02343:Stra6l	APN	4	45869588	missense	probably damaging	0.99
IGL02710:Stra6l	APN	4	45882728	missense	possibly damaging	0.72
IGL02880:Stra6l	APN	4	45885278	missense	possibly damaging	0.70
IGL03034:Stra6l	APN	4	45885392	missense	probably benign	0.41
IGL03163:Stra6l	APN	4	45881455	missense	probably benign	0.03
IGL03355:Stra6l	APN	4	45873689	missense	probably benign	0.16
K2124:Stra6l	UTSW	4	45870770	splice site	probably benign
R0800:Stra6l	UTSW	4	45882797	missense	probably benign	0.29
R1171:Stra6l	UTSW	4	45864982	missense	probably benign
R1931:Stra6l	UTSW	4	45882698	nonsense	probably null
R1982:Stra6l	UTSW	4	45867237	nonsense	probably null
R2331:Stra6l	UTSW	4	45858224	critical splice donor site	probably null
R4846:Stra6l	UTSW	4	45873682	missense	possibly damaging	0.76
R5175:Stra6l	UTSW	4	45870860	missense	probably benign	0.01
R5633:Stra6l	UTSW	4	45881455	missense	probably benign	0.00
R6212:Stra6l	UTSW	4	45884664	missense	probably benign
R6517:Stra6l	UTSW	4	45879473	missense	probably benign
R6534:Stra6l	UTSW	4	45860041	splice site	probably null
R6584:Stra6l	UTSW	4	45869635	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTCTATCTGCAGGAGAGC -3'
(R):5'- GTTCTACAACCTTTGACCACACAG -3'

Sequencing Primer
(F):5'- TATCTGCAGGAGAGCCTTCCAC -3'
(R):5'- ACTAAGCTAAGCTGGCTGTC -3'

Posted On

2015-10-21