Mutagenetix > Incidental Mutation

Incidental Mutation 'R4691:Gcfc2'

354903

Institutional Source

Beutler Lab

Gene Symbol

Gcfc2

Ensembl Gene

ENSMUSG00000035125

Gene Name

GC-rich sequence DNA binding factor 2

Synonyms

AW146020

MMRRC Submission

041942-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.507) question?

Stock #

R4691 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81923669-81959915 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 81941427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 366 (L366*)

Ref Sequence

ENSEMBL: ENSMUSP00000035644 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]

AlphaFold

Q8BKT3

Predicted Effect

probably null
Transcript: ENSMUST00000043195
AA Change: L366*

SMART Domains

Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: L366*

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC
coiled coil region	255	308	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
Pfam:GCFC	456	672	3e-34	PFAM
low complexity region	753	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127949

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132301

Predicted Effect

probably benign
Transcript: ENSMUST00000152996

SMART Domains

Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca13	A	T	11: 9,434,195	R3882S	probably damaging	Het
Adamts2	G	T	11: 50,756,696	V299F	probably damaging	Het
Ankrd50	A	G	3: 38,483,010	S65P	probably benign	Het
Ap4e1	T	C	2: 127,061,871	C898R	probably benign	Het
Arel1	A	T	12: 84,930,249		probably null	Het
Bag6	T	A	17: 35,139,248	V164D	probably damaging	Het
C2cd5	A	G	6: 143,030,148	S769P	possibly damaging	Het
Cables1	C	T	18: 11,840,523	Q240*	probably null	Het
Ccnb1-ps	T	A	7: 42,106,092		noncoding transcript	Het
Ccz1	A	T	5: 143,991,562	I390N	possibly damaging	Het
Ces1a	T	C	8: 93,032,659	H283R	probably benign	Het
Clca3b	G	A	3: 144,839,092	T378I	probably benign	Het
Cpne2	A	T	8: 94,558,221	I342F	probably damaging	Het
Cyp2d9	A	G	15: 82,455,832	D141G	probably damaging	Het
Ddias	T	A	7: 92,858,816	K630N	probably damaging	Het
Dennd4b	A	G	3: 90,272,312	T626A	probably damaging	Het
Disc1	T	C	8: 125,148,447	V554A	possibly damaging	Het
Dnah10	A	G	5: 124,775,517	T1880A	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epop	C	T	11: 97,628,893	G130D	possibly damaging	Het
Erap1	T	C	13: 74,673,692	L722P	probably damaging	Het
Eya4	T	A	10: 23,140,068	T334S	probably benign	Het
Ezr	T	C	17: 6,759,562	I5V	probably benign	Het
Fam53c	A	C	18: 34,768,690	E220A	probably damaging	Het
Galnt12	T	C	4: 47,104,143	S134P	probably damaging	Het
Gins4	T	A	8: 23,237,059	D6V	probably benign	Het
Gm1113	T	C	9: 35,516,862	S106G	possibly damaging	Het
Gm5155	T	A	7: 17,908,966	S434T	possibly damaging	Het
Grid1	A	G	14: 35,569,557	H807R	probably benign	Het
H2-T22	GTTTT	GTTT	17: 36,041,570		probably null	Het
Ighv1-66	T	C	12: 115,593,309	Y51C	probably benign	Het
Inpp4b	A	T	8: 82,122,653	Y901F	probably damaging	Het
Irf2	T	A	8: 46,846,187	S339T	probably damaging	Het
Itgae	G	T	11: 73,119,519	G612*	probably null	Het
Kdr	T	C	5: 75,944,599	K1037R	possibly damaging	Het
Mro	A	T	18: 73,873,326	M115L	probably benign	Het
Myo5a	A	G	9: 75,180,156	E1098G	probably damaging	Het
Nkx2-1	T	A	12: 56,533,565	M197L	probably benign	Het
Olfr58	T	C	9: 19,783,382	I83T	probably benign	Het
Pank2	T	A	2: 131,296,281	F430L	possibly damaging	Het
Pcx	T	A	19: 4,619,477	V794E	probably damaging	Het
Pdgfd	C	T	9: 6,288,556	P70L	probably damaging	Het
Pla2g4e	T	C	2: 120,174,300	Y521C	probably damaging	Het
Pou5f1	T	A	17: 35,506,131	F11Y	probably damaging	Het
Prdm9	A	G	17: 15,553,378	M252T	probably benign	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Rad51ap1	A	G	6: 126,927,553	S123P	probably benign	Het
Robo3	T	C	9: 37,425,218	E418G	probably damaging	Het
Sos2	C	T	12: 69,616,328	R631H	probably damaging	Het
St3gal2	C	T	8: 110,957,785	T25I	probably benign	Het
Stra6l	G	A	4: 45,882,851	A521T	probably benign	Het
Syt7	T	A	19: 10,426,481	L177Q	probably damaging	Het
Tet2	T	A	3: 133,486,083	Q863H	possibly damaging	Het
Tmem232	T	C	17: 65,265,242	K585E	possibly damaging	Het
Trpc6	A	C	9: 8,652,978	E595A	probably damaging	Het
Txnl1	A	G	18: 63,671,679	V248A	possibly damaging	Het
Vmn2r72	A	T	7: 85,737,911	L815*	probably null	Het
Vmn2r81	C	T	10: 79,293,377	Q701*	probably null	Het
Vps13c	T	C	9: 67,952,935	V2811A	possibly damaging	Het
Zfp354a	A	G	11: 51,070,237	E425G	probably damaging	Het
Zfp617	A	T	8: 71,932,815	T330S	probably benign	Het
Zfp663	G	T	2: 165,359,130		probably benign	Het
Zfp84	T	C	7: 29,777,080	L399P	probably damaging	Het
Zfp869	A	T	8: 69,706,863	C353*	probably null	Het
Zscan22	C	T	7: 12,906,561	A85V	probably benign	Het

Other mutations in Gcfc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Gcfc2	APN	6	81936015	missense	probably damaging	0.99
IGL00473:Gcfc2	APN	6	81944374	missense	probably damaging	1.00
IGL00497:Gcfc2	APN	6	81957970	missense	probably benign	0.08
IGL02135:Gcfc2	APN	6	81941400	missense	probably damaging	1.00
R0138:Gcfc2	UTSW	6	81949954	missense	probably damaging	1.00
R0208:Gcfc2	UTSW	6	81943463	missense	probably null	0.91
R0467:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R1105:Gcfc2	UTSW	6	81939453	missense	probably damaging	1.00
R1521:Gcfc2	UTSW	6	81923812	missense	probably benign	0.14
R1602:Gcfc2	UTSW	6	81944420	missense	probably damaging	1.00
R1846:Gcfc2	UTSW	6	81956892	missense	probably damaging	0.99
R2091:Gcfc2	UTSW	6	81943479	missense	probably damaging	1.00
R2110:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2111:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2112:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2892:Gcfc2	UTSW	6	81956913	missense	possibly damaging	0.87
R3792:Gcfc2	UTSW	6	81930767	missense	probably benign	0.00
R4284:Gcfc2	UTSW	6	81941391	missense	probably damaging	1.00
R4304:Gcfc2	UTSW	6	81943007	missense	probably damaging	1.00
R5046:Gcfc2	UTSW	6	81948335	missense	probably benign	0.12
R5233:Gcfc2	UTSW	6	81953290	missense	probably damaging	1.00
R5307:Gcfc2	UTSW	6	81944386	missense	probably damaging	0.97
R5308:Gcfc2	UTSW	6	81943543	critical splice donor site	probably null
R5929:Gcfc2	UTSW	6	81946599	missense	probably damaging	1.00
R6339:Gcfc2	UTSW	6	81946496	missense	probably damaging	1.00
R6485:Gcfc2	UTSW	6	81939547	missense	probably damaging	1.00
R6931:Gcfc2	UTSW	6	81942985	missense	probably benign	0.36
R6948:Gcfc2	UTSW	6	81933753	missense	probably benign	0.01
R7392:Gcfc2	UTSW	6	81943012	critical splice donor site	probably null
R7423:Gcfc2	UTSW	6	81946560	missense	probably damaging	1.00
R7509:Gcfc2	UTSW	6	81953275	missense	probably damaging	1.00
R7713:Gcfc2	UTSW	6	81941390	missense	probably damaging	1.00
R8089:Gcfc2	UTSW	6	81925790	missense	probably damaging	1.00
R8249:Gcfc2	UTSW	6	81956951	missense	probably benign	0.02
R8366:Gcfc2	UTSW	6	81923801	missense	probably benign	0.05
R8553:Gcfc2	UTSW	6	81935963	missense	probably benign	0.01
R8560:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R8779:Gcfc2	UTSW	6	81948317	missense	probably benign	0.00
R8915:Gcfc2	UTSW	6	81941366	missense	probably benign	0.36
R8924:Gcfc2	UTSW	6	81932898	missense	probably damaging	1.00
R9687:Gcfc2	UTSW	6	81941342	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGACTTGCACTAATATTGGAACTAT -3'
(R):5'- CAGGTGCGGGGTAAAGGATT -3'

Sequencing Primer
(F):5'- TTGGTGAACTCCAGCACA -3'
(R):5'- TCCACGGTTCTATTAGAAAGCAGGC -3'

Posted On

2015-10-21