Incidental Mutation 'R4691:Gins4'
ID 354912
Institutional Source Beutler Lab
Gene Symbol Gins4
Ensembl Gene ENSMUSG00000031546
Gene Name GINS complex subunit 4
Synonyms 2810037C03Rik, SLD5, 4933405K01Rik
MMRRC Submission 041942-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4691 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 23716632-23727675 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23727075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 6 (D6V)
Ref Sequence ENSEMBL: ENSMUSP00000033950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033950] [ENSMUST00000051094] [ENSMUST00000121783]
AlphaFold Q99LZ3
Predicted Effect probably benign
Transcript: ENSMUST00000033950
AA Change: D6V

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033950
Gene: ENSMUSG00000031546
AA Change: D6V

DomainStartEndE-ValueType
Pfam:Sld5 20 127 5.3e-9 PFAM
Pfam:SLD5_C 165 223 4.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051094
SMART Domains Protein: ENSMUSP00000062983
Gene: ENSMUSG00000015341

DomainStartEndE-ValueType
Pfam:Erf4 11 125 3.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121783
SMART Domains Protein: ENSMUSP00000112935
Gene: ENSMUSG00000015341

DomainStartEndE-ValueType
Pfam:Erf4 11 125 3.2e-38 PFAM
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]). See GINS1 for additional information about the GINS complex.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant animals do not survive past implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,384,195 (GRCm39) R3882S probably damaging Het
Adamts2 G T 11: 50,647,523 (GRCm39) V299F probably damaging Het
Ankrd50 A G 3: 38,537,159 (GRCm39) S65P probably benign Het
Ap4e1 T C 2: 126,903,791 (GRCm39) C898R probably benign Het
Arel1 A T 12: 84,977,023 (GRCm39) probably null Het
Bag6 T A 17: 35,358,224 (GRCm39) V164D probably damaging Het
C2cd5 A G 6: 142,975,874 (GRCm39) S769P possibly damaging Het
Cables1 C T 18: 11,973,580 (GRCm39) Q240* probably null Het
Ccnb1-ps T A 7: 41,755,516 (GRCm39) noncoding transcript Het
Ccz1 A T 5: 143,928,380 (GRCm39) I390N possibly damaging Het
Ceacam23 T A 7: 17,642,891 (GRCm39) S434T possibly damaging Het
Ces1a T C 8: 93,759,287 (GRCm39) H283R probably benign Het
Clca3b G A 3: 144,544,853 (GRCm39) T378I probably benign Het
Cpne2 A T 8: 95,284,849 (GRCm39) I342F probably damaging Het
Cyp2d9 A G 15: 82,340,033 (GRCm39) D141G probably damaging Het
Ddias T A 7: 92,508,024 (GRCm39) K630N probably damaging Het
Dennd4b A G 3: 90,179,619 (GRCm39) T626A probably damaging Het
Disc1 T C 8: 125,875,186 (GRCm39) V554A possibly damaging Het
Dnah10 A G 5: 124,852,581 (GRCm39) T1880A probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Epop C T 11: 97,519,719 (GRCm39) G130D possibly damaging Het
Erap1 T C 13: 74,821,811 (GRCm39) L722P probably damaging Het
Eya4 T A 10: 23,015,966 (GRCm39) T334S probably benign Het
Ezr T C 17: 7,026,961 (GRCm39) I5V probably benign Het
Fam53c A C 18: 34,901,743 (GRCm39) E220A probably damaging Het
Galnt12 T C 4: 47,104,143 (GRCm39) S134P probably damaging Het
Gcfc2 T A 6: 81,918,408 (GRCm39) L366* probably null Het
Grid1 A G 14: 35,291,514 (GRCm39) H807R probably benign Het
H2-T22 GTTTT GTTT 17: 36,352,462 (GRCm39) probably null Het
Ighv1-66 T C 12: 115,556,929 (GRCm39) Y51C probably benign Het
Inpp4b A T 8: 82,849,282 (GRCm39) Y901F probably damaging Het
Irf2 T A 8: 47,299,222 (GRCm39) S339T probably damaging Het
Itgae G T 11: 73,010,345 (GRCm39) G612* probably null Het
Kdr T C 5: 76,105,259 (GRCm39) K1037R possibly damaging Het
Mro A T 18: 74,006,397 (GRCm39) M115L probably benign Het
Myo5a A G 9: 75,087,438 (GRCm39) E1098G probably damaging Het
Nkx2-1 T A 12: 56,580,350 (GRCm39) M197L probably benign Het
Or7e165 T C 9: 19,694,678 (GRCm39) I83T probably benign Het
Pank2 T A 2: 131,138,201 (GRCm39) F430L possibly damaging Het
Pcx T A 19: 4,669,505 (GRCm39) V794E probably damaging Het
Pdgfd C T 9: 6,288,556 (GRCm39) P70L probably damaging Het
Pla2g4e T C 2: 120,004,781 (GRCm39) Y521C probably damaging Het
Pou5f1 T A 17: 35,817,028 (GRCm39) F11Y probably damaging Het
Prdm9 A G 17: 15,773,640 (GRCm39) M252T probably benign Het
Ptk2b C T 14: 66,394,518 (GRCm39) G859S probably benign Het
Rad51ap1 A G 6: 126,904,516 (GRCm39) S123P probably benign Het
Robo3 T C 9: 37,336,514 (GRCm39) E418G probably damaging Het
Sos2 C T 12: 69,663,102 (GRCm39) R631H probably damaging Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
St3gal2 C T 8: 111,684,417 (GRCm39) T25I probably benign Het
Stra6l G A 4: 45,882,851 (GRCm39) A521T probably benign Het
Syt7 T A 19: 10,403,845 (GRCm39) L177Q probably damaging Het
Tet2 T A 3: 133,191,844 (GRCm39) Q863H possibly damaging Het
Tmem232 T C 17: 65,572,237 (GRCm39) K585E possibly damaging Het
Trpc6 A C 9: 8,652,979 (GRCm39) E595A probably damaging Het
Txnl1 A G 18: 63,804,750 (GRCm39) V248A possibly damaging Het
Vmn2r72 A T 7: 85,387,119 (GRCm39) L815* probably null Het
Vmn2r81 C T 10: 79,129,211 (GRCm39) Q701* probably null Het
Vps13c T C 9: 67,860,217 (GRCm39) V2811A possibly damaging Het
Vsig10l2 T C 9: 35,428,158 (GRCm39) S106G possibly damaging Het
Zfp354a A G 11: 50,961,064 (GRCm39) E425G probably damaging Het
Zfp617 A T 8: 72,686,659 (GRCm39) T330S probably benign Het
Zfp663 G T 2: 165,201,050 (GRCm39) probably benign Het
Zfp84 T C 7: 29,476,505 (GRCm39) L399P probably damaging Het
Zfp869 A T 8: 70,159,513 (GRCm39) C353* probably null Het
Zscan22 C T 7: 12,640,488 (GRCm39) A85V probably benign Het
Other mutations in Gins4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Gins4 APN 8 23,717,343 (GRCm39) missense probably benign 0.38
IGL01824:Gins4 APN 8 23,724,784 (GRCm39) nonsense probably null
IGL02304:Gins4 APN 8 23,722,625 (GRCm39) missense probably benign
IGL03194:Gins4 APN 8 23,724,762 (GRCm39) splice site probably benign
R0058:Gins4 UTSW 8 23,719,526 (GRCm39) splice site probably benign
R0058:Gins4 UTSW 8 23,719,526 (GRCm39) splice site probably benign
R0267:Gins4 UTSW 8 23,719,426 (GRCm39) splice site probably benign
R1428:Gins4 UTSW 8 23,717,144 (GRCm39) missense probably damaging 1.00
R1519:Gins4 UTSW 8 23,724,792 (GRCm39) missense probably benign 0.04
R4933:Gins4 UTSW 8 23,724,796 (GRCm39) missense probably damaging 0.99
R5088:Gins4 UTSW 8 23,727,084 (GRCm39) missense possibly damaging 0.87
R8098:Gins4 UTSW 8 23,727,037 (GRCm39) missense probably benign
R9679:Gins4 UTSW 8 23,717,132 (GRCm39) missense probably damaging 1.00
RF006:Gins4 UTSW 8 23,717,183 (GRCm39) missense possibly damaging 0.71
RF016:Gins4 UTSW 8 23,722,626 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTACAAACACTGCTCTTTGG -3'
(R):5'- TAGTGTGGTATCTGCCCAGG -3'

Sequencing Primer
(F):5'- GCACACCTGGAGTAAGTT -3'
(R):5'- TGGTATCTGCCCAGGTCCAG -3'
Posted On 2015-10-21