Incidental Mutation 'R4691:Zfp354a'
ID354931
Institutional Source Beutler Lab
Gene Symbol Zfp354a
Ensembl Gene ENSMUSG00000020364
Gene Namezinc finger protein 354A
SynonymsTcf17, kid1
MMRRC Submission 041942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4691 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location51059257-51072799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51070237 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 425 (E425G)
Ref Sequence ENSEMBL: ENSMUSP00000104747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020628] [ENSMUST00000102766] [ENSMUST00000109119] [ENSMUST00000109122]
Predicted Effect probably damaging
Transcript: ENSMUST00000020628
AA Change: E424G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020628
Gene: ENSMUSG00000020364
AA Change: E424G

DomainStartEndE-ValueType
KRAB 14 74 8.48e-36 SMART
ZnF_C2H2 184 206 1.12e-3 SMART
ZnF_C2H2 212 234 1.38e-3 SMART
ZnF_C2H2 240 262 9.73e-4 SMART
ZnF_C2H2 268 290 1.72e-4 SMART
ZnF_C2H2 321 343 1.47e-3 SMART
ZnF_C2H2 349 371 4.24e-4 SMART
ZnF_C2H2 377 399 2.79e-4 SMART
ZnF_C2H2 405 427 9.58e-3 SMART
ZnF_C2H2 433 455 2.4e-3 SMART
ZnF_C2H2 461 483 1.2e-3 SMART
ZnF_C2H2 489 511 2.99e-4 SMART
ZnF_C2H2 517 539 5.5e-3 SMART
ZnF_C2H2 545 567 9.08e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102766
AA Change: E424G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099827
Gene: ENSMUSG00000020364
AA Change: E424G

DomainStartEndE-ValueType
KRAB 14 74 8.48e-36 SMART
ZnF_C2H2 184 206 1.12e-3 SMART
ZnF_C2H2 212 234 1.38e-3 SMART
ZnF_C2H2 240 262 9.73e-4 SMART
ZnF_C2H2 268 290 1.72e-4 SMART
ZnF_C2H2 321 343 1.47e-3 SMART
ZnF_C2H2 349 371 4.24e-4 SMART
ZnF_C2H2 377 399 2.79e-4 SMART
ZnF_C2H2 405 427 9.58e-3 SMART
ZnF_C2H2 433 455 2.4e-3 SMART
ZnF_C2H2 461 483 1.2e-3 SMART
ZnF_C2H2 489 511 2.99e-4 SMART
ZnF_C2H2 517 539 5.5e-3 SMART
ZnF_C2H2 545 567 9.08e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109119
AA Change: E425G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104747
Gene: ENSMUSG00000020364
AA Change: E425G

DomainStartEndE-ValueType
KRAB 14 75 1.67e-34 SMART
ZnF_C2H2 185 207 1.12e-3 SMART
ZnF_C2H2 213 235 1.38e-3 SMART
ZnF_C2H2 241 263 9.73e-4 SMART
ZnF_C2H2 269 291 1.72e-4 SMART
ZnF_C2H2 322 344 1.47e-3 SMART
ZnF_C2H2 350 372 4.24e-4 SMART
ZnF_C2H2 378 400 2.79e-4 SMART
ZnF_C2H2 406 428 9.58e-3 SMART
ZnF_C2H2 434 456 2.4e-3 SMART
ZnF_C2H2 462 484 1.2e-3 SMART
ZnF_C2H2 490 512 2.99e-4 SMART
ZnF_C2H2 518 540 5.5e-3 SMART
ZnF_C2H2 546 568 9.08e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109122
AA Change: E423G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104750
Gene: ENSMUSG00000020364
AA Change: E423G

DomainStartEndE-ValueType
KRAB 13 73 8.48e-36 SMART
ZnF_C2H2 183 205 1.12e-3 SMART
ZnF_C2H2 211 233 1.38e-3 SMART
ZnF_C2H2 239 261 9.73e-4 SMART
ZnF_C2H2 267 289 1.72e-4 SMART
ZnF_C2H2 320 342 1.47e-3 SMART
ZnF_C2H2 348 370 4.24e-4 SMART
ZnF_C2H2 376 398 2.79e-4 SMART
ZnF_C2H2 404 426 9.58e-3 SMART
ZnF_C2H2 432 454 2.4e-3 SMART
ZnF_C2H2 460 482 1.2e-3 SMART
ZnF_C2H2 488 510 2.99e-4 SMART
ZnF_C2H2 516 538 5.5e-3 SMART
ZnF_C2H2 544 566 9.08e-4 SMART
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca13 A T 11: 9,434,195 R3882S probably damaging Het
Adamts2 G T 11: 50,756,696 V299F probably damaging Het
Ankrd50 A G 3: 38,483,010 S65P probably benign Het
Ap4e1 T C 2: 127,061,871 C898R probably benign Het
Arel1 A T 12: 84,930,249 probably null Het
Bag6 T A 17: 35,139,248 V164D probably damaging Het
C2cd5 A G 6: 143,030,148 S769P possibly damaging Het
Cables1 C T 18: 11,840,523 Q240* probably null Het
Ccnb1-ps T A 7: 42,106,092 noncoding transcript Het
Ccz1 A T 5: 143,991,562 I390N possibly damaging Het
Ces1a T C 8: 93,032,659 H283R probably benign Het
Clca3b G A 3: 144,839,092 T378I probably benign Het
Cpne2 A T 8: 94,558,221 I342F probably damaging Het
Cyp2d9 A G 15: 82,455,832 D141G probably damaging Het
Ddias T A 7: 92,858,816 K630N probably damaging Het
Dennd4b A G 3: 90,272,312 T626A probably damaging Het
Disc1 T C 8: 125,148,447 V554A possibly damaging Het
Dnah10 A G 5: 124,775,517 T1880A probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epop C T 11: 97,628,893 G130D possibly damaging Het
Erap1 T C 13: 74,673,692 L722P probably damaging Het
Eya4 T A 10: 23,140,068 T334S probably benign Het
Ezr T C 17: 6,759,562 I5V probably benign Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Galnt12 T C 4: 47,104,143 S134P probably damaging Het
Gcfc2 T A 6: 81,941,427 L366* probably null Het
Gins4 T A 8: 23,237,059 D6V probably benign Het
Gm1113 T C 9: 35,516,862 S106G possibly damaging Het
Gm5155 T A 7: 17,908,966 S434T possibly damaging Het
Grid1 A G 14: 35,569,557 H807R probably benign Het
H2-T22 GTTTT GTTT 17: 36,041,570 probably null Het
Ighv1-66 T C 12: 115,593,309 Y51C probably benign Het
Inpp4b A T 8: 82,122,653 Y901F probably damaging Het
Irf2 T A 8: 46,846,187 S339T probably damaging Het
Itgae G T 11: 73,119,519 G612* probably null Het
Kdr T C 5: 75,944,599 K1037R possibly damaging Het
Mro A T 18: 73,873,326 M115L probably benign Het
Myo5a A G 9: 75,180,156 E1098G probably damaging Het
Nkx2-1 T A 12: 56,533,565 M197L probably benign Het
Olfr58 T C 9: 19,783,382 I83T probably benign Het
Pank2 T A 2: 131,296,281 F430L possibly damaging Het
Pcx T A 19: 4,619,477 V794E probably damaging Het
Pdgfd C T 9: 6,288,556 P70L probably damaging Het
Pla2g4e T C 2: 120,174,300 Y521C probably damaging Het
Pou5f1 T A 17: 35,506,131 F11Y probably damaging Het
Prdm9 A G 17: 15,553,378 M252T probably benign Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rad51ap1 A G 6: 126,927,553 S123P probably benign Het
Robo3 T C 9: 37,425,218 E418G probably damaging Het
Sos2 C T 12: 69,616,328 R631H probably damaging Het
St3gal2 C T 8: 110,957,785 T25I probably benign Het
Stra6l G A 4: 45,882,851 A521T probably benign Het
Syt7 T A 19: 10,426,481 L177Q probably damaging Het
Tet2 T A 3: 133,486,083 Q863H possibly damaging Het
Tmem232 T C 17: 65,265,242 K585E possibly damaging Het
Trpc6 A C 9: 8,652,978 E595A probably damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Vmn2r72 A T 7: 85,737,911 L815* probably null Het
Vmn2r81 C T 10: 79,293,377 Q701* probably null Het
Vps13c T C 9: 67,952,935 V2811A possibly damaging Het
Zfp617 A T 8: 71,932,815 T330S probably benign Het
Zfp663 G T 2: 165,359,130 probably benign Het
Zfp84 T C 7: 29,777,080 L399P probably damaging Het
Zfp869 A T 8: 69,706,863 C353* probably null Het
Zscan22 C T 7: 12,906,561 A85V probably benign Het
Other mutations in Zfp354a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Zfp354a APN 11 51069363 missense probably benign 0.00
IGL00518:Zfp354a APN 11 51070554 missense probably damaging 1.00
IGL01872:Zfp354a APN 11 51069337 missense possibly damaging 0.59
P0026:Zfp354a UTSW 11 51061498 missense probably null 0.40
R0063:Zfp354a UTSW 11 51069571 missense probably damaging 1.00
R0063:Zfp354a UTSW 11 51069571 missense probably damaging 1.00
R1013:Zfp354a UTSW 11 51060850 splice site probably benign
R1498:Zfp354a UTSW 11 51070246 missense probably damaging 1.00
R2093:Zfp354a UTSW 11 51069724 missense probably damaging 0.99
R4630:Zfp354a UTSW 11 51070218 missense probably damaging 1.00
R5224:Zfp354a UTSW 11 51070049 missense probably damaging 1.00
R5728:Zfp354a UTSW 11 51070605 missense probably damaging 1.00
R6209:Zfp354a UTSW 11 51060988 critical splice donor site probably null
R6831:Zfp354a UTSW 11 51070554 missense probably damaging 1.00
R7206:Zfp354a UTSW 11 51070246 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCTACTTCCCTTTCAGGATG -3'
(R):5'- GCTGAACTTTGACCAAATGACATC -3'

Sequencing Primer
(F):5'- GACCTACTTGTGCAACGAATGTG -3'
(R):5'- GGTACGGCTTCTCTCCAGTG -3'
Posted On2015-10-21