Incidental Mutation 'R4691:Bag6'
ID354944
Institutional Source Beutler Lab
Gene Symbol Bag6
Ensembl Gene ENSMUSG00000024392
Gene NameBCL2-associated athanogene 6
SynonymsScythe, G3, D17H6S52E, Bat3, 2410045D21Rik
MMRRC Submission 041942-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4691 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35135178-35147322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35139248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 164 (V164D)
Ref Sequence ENSEMBL: ENSMUSP00000134425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025250] [ENSMUST00000166426] [ENSMUST00000172571] [ENSMUST00000173491] [ENSMUST00000173535] [ENSMUST00000173550] [ENSMUST00000173952] [ENSMUST00000174281] [ENSMUST00000174478]
Predicted Effect probably damaging
Transcript: ENSMUST00000025250
AA Change: V164D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025250
Gene: ENSMUSG00000024392
AA Change: V164D

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 1.7e-44 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 557 625 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
low complexity region 673 721 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
low complexity region 765 780 N/A INTRINSIC
low complexity region 798 808 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
low complexity region 1088 1098 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166426
AA Change: V146D
SMART Domains Protein: ENSMUSP00000129324
Gene: ENSMUSG00000024392
AA Change: V146D

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 539 607 N/A INTRINSIC
low complexity region 614 630 N/A INTRINSIC
low complexity region 655 703 N/A INTRINSIC
low complexity region 707 729 N/A INTRINSIC
low complexity region 747 762 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1070 1080 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172571
AA Change: V146D
SMART Domains Protein: ENSMUSP00000134175
Gene: ENSMUSG00000024392
AA Change: V146D

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 252 N/A INTRINSIC
Pfam:DUF3538 254 370 3.5e-53 PFAM
low complexity region 404 415 N/A INTRINSIC
low complexity region 534 602 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 650 698 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 742 757 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173351
Predicted Effect possibly damaging
Transcript: ENSMUST00000173491
AA Change: V164D

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134279
Gene: ENSMUSG00000024392
AA Change: V164D

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173535
AA Change: V205D

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133822
Gene: ENSMUSG00000024392
AA Change: V205D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 261 280 N/A INTRINSIC
low complexity region 287 305 N/A INTRINSIC
Pfam:DUF3538 318 434 1.3e-53 PFAM
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173550
AA Change: V146D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134628
Gene: ENSMUSG00000024392
AA Change: V146D

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 496 511 N/A INTRINSIC
low complexity region 574 642 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 690 738 N/A INTRINSIC
low complexity region 742 764 N/A INTRINSIC
low complexity region 782 797 N/A INTRINSIC
low complexity region 815 825 N/A INTRINSIC
low complexity region 1046 1059 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173952
AA Change: V187D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134717
Gene: ENSMUSG00000024392
AA Change: V187D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174281
AA Change: V164D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134425
Gene: ENSMUSG00000024392
AA Change: V164D

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 3.6e-53 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
low complexity region 592 660 N/A INTRINSIC
low complexity region 667 683 N/A INTRINSIC
low complexity region 708 756 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 1064 1077 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174478
SMART Domains Protein: ENSMUSP00000138117
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174797
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in either embryonic lethality following abnormal brain development or neonatal death associated with severe developmental defects in the lung and kidney. These developmental defects are associated with widespread aberrant apoptosis and proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca13 A T 11: 9,434,195 R3882S probably damaging Het
Adamts2 G T 11: 50,756,696 V299F probably damaging Het
Ankrd50 A G 3: 38,483,010 S65P probably benign Het
Ap4e1 T C 2: 127,061,871 C898R probably benign Het
Arel1 A T 12: 84,930,249 probably null Het
C2cd5 A G 6: 143,030,148 S769P possibly damaging Het
Cables1 C T 18: 11,840,523 Q240* probably null Het
Ccnb1-ps T A 7: 42,106,092 noncoding transcript Het
Ccz1 A T 5: 143,991,562 I390N possibly damaging Het
Ces1a T C 8: 93,032,659 H283R probably benign Het
Clca3b G A 3: 144,839,092 T378I probably benign Het
Cpne2 A T 8: 94,558,221 I342F probably damaging Het
Cyp2d9 A G 15: 82,455,832 D141G probably damaging Het
Ddias T A 7: 92,858,816 K630N probably damaging Het
Dennd4b A G 3: 90,272,312 T626A probably damaging Het
Disc1 T C 8: 125,148,447 V554A possibly damaging Het
Dnah10 A G 5: 124,775,517 T1880A probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epop C T 11: 97,628,893 G130D possibly damaging Het
Erap1 T C 13: 74,673,692 L722P probably damaging Het
Eya4 T A 10: 23,140,068 T334S probably benign Het
Ezr T C 17: 6,759,562 I5V probably benign Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Galnt12 T C 4: 47,104,143 S134P probably damaging Het
Gcfc2 T A 6: 81,941,427 L366* probably null Het
Gins4 T A 8: 23,237,059 D6V probably benign Het
Gm1113 T C 9: 35,516,862 S106G possibly damaging Het
Gm5155 T A 7: 17,908,966 S434T possibly damaging Het
Grid1 A G 14: 35,569,557 H807R probably benign Het
H2-T22 GTTTT GTTT 17: 36,041,570 probably null Het
Ighv1-66 T C 12: 115,593,309 Y51C probably benign Het
Inpp4b A T 8: 82,122,653 Y901F probably damaging Het
Irf2 T A 8: 46,846,187 S339T probably damaging Het
Itgae G T 11: 73,119,519 G612* probably null Het
Kdr T C 5: 75,944,599 K1037R possibly damaging Het
Mro A T 18: 73,873,326 M115L probably benign Het
Myo5a A G 9: 75,180,156 E1098G probably damaging Het
Nkx2-1 T A 12: 56,533,565 M197L probably benign Het
Olfr58 T C 9: 19,783,382 I83T probably benign Het
Pank2 T A 2: 131,296,281 F430L possibly damaging Het
Pcx T A 19: 4,619,477 V794E probably damaging Het
Pdgfd C T 9: 6,288,556 P70L probably damaging Het
Pla2g4e T C 2: 120,174,300 Y521C probably damaging Het
Pou5f1 T A 17: 35,506,131 F11Y probably damaging Het
Prdm9 A G 17: 15,553,378 M252T probably benign Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rad51ap1 A G 6: 126,927,553 S123P probably benign Het
Robo3 T C 9: 37,425,218 E418G probably damaging Het
Sos2 C T 12: 69,616,328 R631H probably damaging Het
St3gal2 C T 8: 110,957,785 T25I probably benign Het
Stra6l G A 4: 45,882,851 A521T probably benign Het
Syt7 T A 19: 10,426,481 L177Q probably damaging Het
Tet2 T A 3: 133,486,083 Q863H possibly damaging Het
Tmem232 T C 17: 65,265,242 K585E possibly damaging Het
Trpc6 A C 9: 8,652,978 E595A probably damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Vmn2r72 A T 7: 85,737,911 L815* probably null Het
Vmn2r81 C T 10: 79,293,377 Q701* probably null Het
Vps13c T C 9: 67,952,935 V2811A possibly damaging Het
Zfp354a A G 11: 51,070,237 E425G probably damaging Het
Zfp617 A T 8: 71,932,815 T330S probably benign Het
Zfp663 G T 2: 165,359,130 probably benign Het
Zfp84 T C 7: 29,777,080 L399P probably damaging Het
Zfp869 A T 8: 69,706,863 C353* probably null Het
Zscan22 C T 7: 12,906,561 A85V probably benign Het
Other mutations in Bag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL00489:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL01613:Bag6 APN 17 35143016 unclassified probably benign
IGL01735:Bag6 APN 17 35145761 unclassified probably benign
IGL02146:Bag6 APN 17 35136215 missense probably damaging 1.00
IGL03092:Bag6 APN 17 35145627 missense probably damaging 1.00
IGL03377:Bag6 APN 17 35144982 missense probably damaging 1.00
R0196:Bag6 UTSW 17 35144263 missense probably damaging 1.00
R0449:Bag6 UTSW 17 35141466 missense probably damaging 1.00
R1228:Bag6 UTSW 17 35145333 missense probably damaging 0.99
R1450:Bag6 UTSW 17 35141958 missense probably benign 0.01
R1686:Bag6 UTSW 17 35144952 missense possibly damaging 0.84
R1869:Bag6 UTSW 17 35142826 missense probably benign 0.05
R2034:Bag6 UTSW 17 35144692 missense probably damaging 0.99
R2205:Bag6 UTSW 17 35144607 missense probably damaging 1.00
R2428:Bag6 UTSW 17 35147175 missense probably damaging 1.00
R2987:Bag6 UTSW 17 35145685 nonsense probably null
R4705:Bag6 UTSW 17 35142343 missense probably damaging 1.00
R4905:Bag6 UTSW 17 35145186 missense probably damaging 1.00
R5001:Bag6 UTSW 17 35145176 missense probably damaging 1.00
R5168:Bag6 UTSW 17 35144695 missense probably damaging 1.00
R5808:Bag6 UTSW 17 35146322 missense probably damaging 1.00
R6118:Bag6 UTSW 17 35143624 missense probably damaging 0.99
R6212:Bag6 UTSW 17 35140302 missense probably benign 0.17
R6279:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6300:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6564:Bag6 UTSW 17 35140371 missense probably damaging 0.98
R6783:Bag6 UTSW 17 35144235 missense possibly damaging 0.94
R6927:Bag6 UTSW 17 35145922 critical splice donor site probably null
R7226:Bag6 UTSW 17 35142945 missense unknown
R7490:Bag6 UTSW 17 35140842 missense unknown
R7499:Bag6 UTSW 17 35144392 missense probably benign 0.29
X0025:Bag6 UTSW 17 35146077 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATTCAGGTATTGAGGGGCC -3'
(R):5'- CAAGGACACTATCTATCTCTGCC -3'

Sequencing Primer
(F):5'- ATTGAGGGGCCTGGGAG -3'
(R):5'- TCTGCCTAAGAGAACTACAGAGG -3'
Posted On2015-10-21