Mutagenetix > Incidental Mutation

Incidental Mutation 'R4691:Cables1'

354948

Institutional Source

Beutler Lab

Gene Symbol

Cables1

Ensembl Gene

ENSMUSG00000040957

Gene Name

CDK5 and Abl enzyme substrate 1

Synonyms

ik3-1, interactor-1 with cdk3

MMRRC Submission

041942-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.685) question?

Stock #

R4691 (G1)

Quality Score

147

Status

Validated

Chromosome

Chromosomal Location

11839220-11945630 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 11840523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 240 (Q240*)

Ref Sequence

ENSEMBL: ENSMUSP00000129463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046948] [ENSMUST00000171109]

AlphaFold

Q9ESJ1

Predicted Effect

probably null
Transcript: ENSMUST00000046948
AA Change: Q240*

SMART Domains

Protein: ENSMUSP00000040639
Gene: ENSMUSG00000040957
AA Change: Q240*

Domain	Start	End	E-Value	Type
low complexity region	2	31	N/A	INTRINSIC
low complexity region	34	46	N/A	INTRINSIC
low complexity region	81	88	N/A	INTRINSIC
low complexity region	93	102	N/A	INTRINSIC
low complexity region	108	138	N/A	INTRINSIC
low complexity region	184	201	N/A	INTRINSIC
low complexity region	238	253	N/A	INTRINSIC
CYCLIN	456	544	1.83e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122616

Predicted Effect

probably null
Transcript: ENSMUST00000171109
AA Change: Q240*

SMART Domains

Protein: ENSMUSP00000129463
Gene: ENSMUSG00000040957
AA Change: Q240*

Domain	Start	End	E-Value	Type
low complexity region	2	31	N/A	INTRINSIC
low complexity region	34	46	N/A	INTRINSIC
low complexity region	81	88	N/A	INTRINSIC
low complexity region	93	102	N/A	INTRINSIC
low complexity region	108	138	N/A	INTRINSIC
low complexity region	184	201	N/A	INTRINSIC
low complexity region	238	253	N/A	INTRINSIC
CYCLIN	482	570	1.83e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180860

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224036

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225430

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null females exhibited reduced fertility and uterine hyperplasia. With chronic exposure to estrogen, homozygous females develop endometrial adenocarcinoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca13	A	T	11: 9,434,195	R3882S	probably damaging	Het
Adamts2	G	T	11: 50,756,696	V299F	probably damaging	Het
Ankrd50	A	G	3: 38,483,010	S65P	probably benign	Het
Ap4e1	T	C	2: 127,061,871	C898R	probably benign	Het
Arel1	A	T	12: 84,930,249		probably null	Het
Bag6	T	A	17: 35,139,248	V164D	probably damaging	Het
C2cd5	A	G	6: 143,030,148	S769P	possibly damaging	Het
Ccnb1-ps	T	A	7: 42,106,092		noncoding transcript	Het
Ccz1	A	T	5: 143,991,562	I390N	possibly damaging	Het
Ces1a	T	C	8: 93,032,659	H283R	probably benign	Het
Clca3b	G	A	3: 144,839,092	T378I	probably benign	Het
Cpne2	A	T	8: 94,558,221	I342F	probably damaging	Het
Cyp2d9	A	G	15: 82,455,832	D141G	probably damaging	Het
Ddias	T	A	7: 92,858,816	K630N	probably damaging	Het
Dennd4b	A	G	3: 90,272,312	T626A	probably damaging	Het
Disc1	T	C	8: 125,148,447	V554A	possibly damaging	Het
Dnah10	A	G	5: 124,775,517	T1880A	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epop	C	T	11: 97,628,893	G130D	possibly damaging	Het
Erap1	T	C	13: 74,673,692	L722P	probably damaging	Het
Eya4	T	A	10: 23,140,068	T334S	probably benign	Het
Ezr	T	C	17: 6,759,562	I5V	probably benign	Het
Fam53c	A	C	18: 34,768,690	E220A	probably damaging	Het
Galnt12	T	C	4: 47,104,143	S134P	probably damaging	Het
Gcfc2	T	A	6: 81,941,427	L366*	probably null	Het
Gins4	T	A	8: 23,237,059	D6V	probably benign	Het
Gm1113	T	C	9: 35,516,862	S106G	possibly damaging	Het
Gm5155	T	A	7: 17,908,966	S434T	possibly damaging	Het
Grid1	A	G	14: 35,569,557	H807R	probably benign	Het
H2-T22	GTTTT	GTTT	17: 36,041,570		probably null	Het
Ighv1-66	T	C	12: 115,593,309	Y51C	probably benign	Het
Inpp4b	A	T	8: 82,122,653	Y901F	probably damaging	Het
Irf2	T	A	8: 46,846,187	S339T	probably damaging	Het
Itgae	G	T	11: 73,119,519	G612*	probably null	Het
Kdr	T	C	5: 75,944,599	K1037R	possibly damaging	Het
Mro	A	T	18: 73,873,326	M115L	probably benign	Het
Myo5a	A	G	9: 75,180,156	E1098G	probably damaging	Het
Nkx2-1	T	A	12: 56,533,565	M197L	probably benign	Het
Olfr58	T	C	9: 19,783,382	I83T	probably benign	Het
Pank2	T	A	2: 131,296,281	F430L	possibly damaging	Het
Pcx	T	A	19: 4,619,477	V794E	probably damaging	Het
Pdgfd	C	T	9: 6,288,556	P70L	probably damaging	Het
Pla2g4e	T	C	2: 120,174,300	Y521C	probably damaging	Het
Pou5f1	T	A	17: 35,506,131	F11Y	probably damaging	Het
Prdm9	A	G	17: 15,553,378	M252T	probably benign	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Rad51ap1	A	G	6: 126,927,553	S123P	probably benign	Het
Robo3	T	C	9: 37,425,218	E418G	probably damaging	Het
Sos2	C	T	12: 69,616,328	R631H	probably damaging	Het
St3gal2	C	T	8: 110,957,785	T25I	probably benign	Het
Stra6l	G	A	4: 45,882,851	A521T	probably benign	Het
Syt7	T	A	19: 10,426,481	L177Q	probably damaging	Het
Tet2	T	A	3: 133,486,083	Q863H	possibly damaging	Het
Tmem232	T	C	17: 65,265,242	K585E	possibly damaging	Het
Trpc6	A	C	9: 8,652,978	E595A	probably damaging	Het
Txnl1	A	G	18: 63,671,679	V248A	possibly damaging	Het
Vmn2r72	A	T	7: 85,737,911	L815*	probably null	Het
Vmn2r81	C	T	10: 79,293,377	Q701*	probably null	Het
Vps13c	T	C	9: 67,952,935	V2811A	possibly damaging	Het
Zfp354a	A	G	11: 51,070,237	E425G	probably damaging	Het
Zfp617	A	T	8: 71,932,815	T330S	probably benign	Het
Zfp663	G	T	2: 165,359,130		probably benign	Het
Zfp84	T	C	7: 29,777,080	L399P	probably damaging	Het
Zfp869	A	T	8: 69,706,863	C353*	probably null	Het
Zscan22	C	T	7: 12,906,561	A85V	probably benign	Het

Other mutations in Cables1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Cables1	APN	18	11944564	missense	probably damaging	0.99
IGL01373:Cables1	APN	18	11888764	missense	probably damaging	0.98
R0058:Cables1	UTSW	18	11923413	missense	possibly damaging	0.80
R0058:Cables1	UTSW	18	11923413	missense	possibly damaging	0.80
R2886:Cables1	UTSW	18	11939732	missense	possibly damaging	0.80
R4845:Cables1	UTSW	18	11944488	missense	probably damaging	0.99
R4964:Cables1	UTSW	18	11941277	missense	possibly damaging	0.92
R5286:Cables1	UTSW	18	11924827	missense	probably benign	0.11
R5756:Cables1	UTSW	18	11941353	missense	probably damaging	1.00
R6755:Cables1	UTSW	18	11939825	missense	probably null	1.00
R7162:Cables1	UTSW	18	11926366	critical splice donor site	probably null
R7242:Cables1	UTSW	18	11840007	missense	possibly damaging	0.93
R7410:Cables1	UTSW	18	11941225	missense	probably benign
R7411:Cables1	UTSW	18	11840515	missense	probably benign	0.01
R7965:Cables1	UTSW	18	11840212	missense	probably benign	0.06
R8765:Cables1	UTSW	18	11923365	missense	probably benign	0.01
R9167:Cables1	UTSW	18	11905972	missense	possibly damaging	0.95
Z1177:Cables1	UTSW	18	11941317	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGATGCCTTCACCAACGTG -3'
(R):5'- CCAAAGCAAGAGCATGGTGC -3'

Sequencing Primer
(F):5'- AACGTGCAGGTGCCATC -3'
(R):5'- CTCTGCTAGTGCCGGGTTC -3'

Posted On

2015-10-21