Incidental Mutation 'R4692:Gsn'
ID354960
Institutional Source Beutler Lab
Gene Symbol Gsn
Ensembl Gene ENSMUSG00000026879
Gene Namegelsolin
Synonyms
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35256380-35307892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35298871 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 434 (Y434C)
Ref Sequence ENSEMBL: ENSMUSP00000144296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028239] [ENSMUST00000201185] [ENSMUST00000202990]
Predicted Effect probably damaging
Transcript: ENSMUST00000028239
AA Change: Y472C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028239
Gene: ENSMUSG00000026879
AA Change: Y472C

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
GEL 64 162 7.31e-30 SMART
GEL 183 275 1.53e-32 SMART
GEL 299 394 2.59e-30 SMART
GEL 443 540 9.28e-32 SMART
GEL 561 646 1.67e-24 SMART
GEL 666 761 4.04e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201185
AA Change: Y423C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144561
Gene: ENSMUSG00000026879
AA Change: Y423C

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
GEL 250 345 1.6e-32 SMART
GEL 394 491 5.8e-34 SMART
GEL 512 597 1.1e-26 SMART
GEL 617 712 2.7e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202990
AA Change: Y434C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144296
Gene: ENSMUSG00000026879
AA Change: Y434C

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
GEL 145 237 9.6e-35 SMART
GEL 261 356 1.6e-32 SMART
GEL 405 502 5.8e-34 SMART
Meta Mutation Damage Score 0.9697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in the immune system, platelet and platelet function, bone density, nervous and circulatory system. In addition, there are background related effects on viability and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Gsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Gsn APN 2 35284037 missense probably damaging 1.00
IGL02119:Gsn APN 2 35302495 missense probably damaging 1.00
IGL02512:Gsn APN 2 35283950 nonsense probably null
IGL02550:Gsn APN 2 35282607 intron probably benign
IGL02975:Gsn APN 2 35304654 missense probably benign 0.25
IGL03061:Gsn APN 2 35282459 intron probably benign
R0321:Gsn UTSW 2 35290396 missense probably benign 0.03
R0454:Gsn UTSW 2 35304639 missense probably damaging 1.00
R1446:Gsn UTSW 2 35306586 missense probably benign 0.04
R1760:Gsn UTSW 2 35284823 missense probably damaging 1.00
R1974:Gsn UTSW 2 35301471 missense probably damaging 1.00
R2258:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2260:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2281:Gsn UTSW 2 35283918 missense probably benign 0.01
R2495:Gsn UTSW 2 35303193 missense probably damaging 1.00
R2516:Gsn UTSW 2 35283953 missense probably benign
R3896:Gsn UTSW 2 35302638 missense possibly damaging 0.92
R4003:Gsn UTSW 2 35283983 missense probably benign 0.38
R4006:Gsn UTSW 2 35307621 nonsense probably null
R4281:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4291:Gsn UTSW 2 35290420 missense probably benign 0.14
R4850:Gsn UTSW 2 35283900 splice site probably null
R4895:Gsn UTSW 2 35302578 missense probably damaging 1.00
R5011:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5013:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5290:Gsn UTSW 2 35296472 missense probably benign 0.01
R6472:Gsn UTSW 2 35290451 splice site probably null
R6764:Gsn UTSW 2 35284044 missense probably damaging 1.00
R7018:Gsn UTSW 2 35293506 missense probably benign 0.03
R7036:Gsn UTSW 2 35292599 missense probably damaging 1.00
R7097:Gsn UTSW 2 35295049 nonsense probably null
R7122:Gsn UTSW 2 35295049 nonsense probably null
R7183:Gsn UTSW 2 35294948 missense probably benign 0.00
R7203:Gsn UTSW 2 35298795 missense probably benign 0.00
R7456:Gsn UTSW 2 35282706 missense possibly damaging 0.84
R7488:Gsn UTSW 2 35296421 missense possibly damaging 0.65
R7880:Gsn UTSW 2 35283927 missense probably damaging 1.00
R8088:Gsn UTSW 2 35292647 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCGCCGGGCAAATTATTTAAC -3'
(R):5'- GTGACTCTGCTTGAGAACGG -3'

Sequencing Primer
(F):5'- GCGTTCCCATGAAAAACTTGTC -3'
(R):5'- CCAGCAAGGTATGGCTGTC -3'
Posted On2015-10-21