Incidental Mutation 'R4692:Olfr1314'
ID354962
Institutional Source Beutler Lab
Gene Symbol Olfr1314
Ensembl Gene ENSMUSG00000074945
Gene Nameolfactory receptor 1314
SynonymsGA_x6K02T2Q125-73139026-73138088, MOR245-2
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112089786-112096781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112092681 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 7 (S7P)
Ref Sequence ENSEMBL: ENSMUSP00000146418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099598] [ENSMUST00000207976]
Predicted Effect probably damaging
Transcript: ENSMUST00000099598
AA Change: S7P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097193
Gene: ENSMUSG00000074945
AA Change: S7P

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 9.2e-42 PFAM
Pfam:7tm_1 41 287 1.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207976
AA Change: S7P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Olfr1314
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Olfr1314 APN 2 112092094 missense probably damaging 0.99
IGL01701:Olfr1314 APN 2 112092506 missense possibly damaging 0.69
IGL02085:Olfr1314 APN 2 112092524 missense probably damaging 1.00
IGL02156:Olfr1314 APN 2 112092016 missense probably benign 0.12
IGL02266:Olfr1314 APN 2 112092243 missense probably benign 0.05
IGL02396:Olfr1314 APN 2 112092467 missense probably benign 0.20
IGL02602:Olfr1314 APN 2 112092561 missense probably benign 0.00
IGL03130:Olfr1314 APN 2 112091821 missense probably benign
R0452:Olfr1314 UTSW 2 112092636 nonsense probably null
R1498:Olfr1314 UTSW 2 112092593 missense probably benign 0.40
R1514:Olfr1314 UTSW 2 112092036 missense probably benign 0.01
R1852:Olfr1314 UTSW 2 112091847 missense probably benign 0.03
R2118:Olfr1314 UTSW 2 112092330 missense probably benign 0.02
R2219:Olfr1314 UTSW 2 112092407 missense probably damaging 0.99
R2357:Olfr1314 UTSW 2 112092398 missense possibly damaging 0.69
R3743:Olfr1314 UTSW 2 112092620 missense probably benign 0.33
R5092:Olfr1314 UTSW 2 112092107 missense possibly damaging 0.94
R5150:Olfr1314 UTSW 2 112092535 missense possibly damaging 0.95
R5230:Olfr1314 UTSW 2 112092389 missense probably benign 0.12
R5991:Olfr1314 UTSW 2 112092615 missense probably benign 0.30
R7894:Olfr1314 UTSW 2 112092477 missense probably benign
Z1177:Olfr1314 UTSW 2 112092584 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGCCAACAGGAAGTACATG -3'
(R):5'- CCCTATACATTGGAAGGCAGTAG -3'

Sequencing Primer
(F):5'- TACATGAGAGAATGTAAGTGGGGGTC -3'
(R):5'- CAGAGTATTTGTAATTTGCAGTCCCC -3'
Posted On2015-10-21