Incidental Mutation 'R4692:Cyp7b1'
ID354963
Institutional Source Beutler Lab
Gene Symbol Cyp7b1
Ensembl Gene ENSMUSG00000039519
Gene Namecytochrome P450, family 7, subfamily b, polypeptide 1
SynonymsD3Ertd552e, hct-1
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location18071950-18243338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18072564 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 473 (I473F)
Ref Sequence ENSEMBL: ENSMUSP00000037487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035625]
Predicted Effect probably damaging
Transcript: ENSMUST00000035625
AA Change: I473F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037487
Gene: ENSMUSG00000039519
AA Change: I473F

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
Pfam:p450 44 496 1e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178937
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway of extrahepatic tissues, which converts cholesterol to bile acids. This enzyme likely plays a minor role in total bile acid synthesis, but may also be involved in the development of atherosclerosis, neurosteroid metabolism and sex hormone synthesis. Mutations in this gene have been associated with hereditary spastic paraplegia (SPG5 or HSP), an autosomal recessive disorder. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show significantly increased levels of 25- and 27-hydroxycholesterol, and reduced IgA levels. Female mice homozygous for a reporter allele display early onset of puberty and early ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Cyp7b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Cyp7b1 APN 3 18072575 missense probably damaging 1.00
R0166:Cyp7b1 UTSW 3 18097366 missense probably benign 0.23
R0334:Cyp7b1 UTSW 3 18103796 missense probably damaging 1.00
R0417:Cyp7b1 UTSW 3 18096691 missense probably damaging 1.00
R0696:Cyp7b1 UTSW 3 18072585 missense probably benign 0.23
R0894:Cyp7b1 UTSW 3 18097510 missense probably benign 0.00
R1799:Cyp7b1 UTSW 3 18097452 missense probably benign 0.01
R1893:Cyp7b1 UTSW 3 18096567 missense possibly damaging 0.57
R4538:Cyp7b1 UTSW 3 18097581 missense possibly damaging 0.71
R4877:Cyp7b1 UTSW 3 18097293 missense probably damaging 0.98
R5382:Cyp7b1 UTSW 3 18097221 missense possibly damaging 0.53
R5841:Cyp7b1 UTSW 3 18097506 missense probably damaging 1.00
R6867:Cyp7b1 UTSW 3 18097230 missense probably damaging 1.00
R7007:Cyp7b1 UTSW 3 18097618 nonsense probably null
R7379:Cyp7b1 UTSW 3 18097374 missense probably benign 0.23
R7554:Cyp7b1 UTSW 3 18097446 missense probably benign 0.00
R7814:Cyp7b1 UTSW 3 18097302 missense probably benign 0.00
R8137:Cyp7b1 UTSW 3 18097601 missense probably benign 0.23
R8338:Cyp7b1 UTSW 3 18097566 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTTCAAACAAGAGTAGCGGTTGC -3'
(R):5'- CTACAGGAATTTAGGTTCGATCGC -3'

Sequencing Primer
(F):5'- CATTTGGGGGAGTGCACCAAATC -3'
(R):5'- AGGTTCGATCGCTTCATAGAAG -3'
Posted On2015-10-21