Incidental Mutation 'R4692:Paxip1'
ID354965
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene NamePAX interacting (with transcription-activation domain) protein 1
SynonymsD5Ertd149e, PTIP
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location27740080-27791691 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 27772097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291] [ENSMUST00000196734]
Predicted Effect unknown
Transcript: ENSMUST00000002291
AA Change: I322M
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: I322M

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196734
SMART Domains Protein: ENSMUSP00000142578
Gene: ENSMUSG00000002221

DomainStartEndE-ValueType
Blast:BRCT 10 83 5e-48 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27772552 utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27748859 missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27751038 missense probably benign 0.17
IGL02143:Paxip1 APN 5 27775598 utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27759395 missense probably benign 0.30
IGL02903:Paxip1 APN 5 27748872 missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27752766 missense probably benign 0.01
BB003:Paxip1 UTSW 5 27791209 missense unknown
BB013:Paxip1 UTSW 5 27791209 missense unknown
R0128:Paxip1 UTSW 5 27744185 splice site probably benign
R0130:Paxip1 UTSW 5 27744185 splice site probably benign
R0331:Paxip1 UTSW 5 27765232 missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27758623 splice site probably benign
R0370:Paxip1 UTSW 5 27760086 missense probably damaging 1.00
R0625:Paxip1 UTSW 5 27765942 nonsense probably null
R1969:Paxip1 UTSW 5 27744136 missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27742501 missense probably damaging 1.00
R3424:Paxip1 UTSW 5 27775673 utr 3 prime probably benign
R3808:Paxip1 UTSW 5 27772029 unclassified probably benign
R3809:Paxip1 UTSW 5 27772029 unclassified probably benign
R3881:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R3882:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27761677 splice site probably null
R4776:Paxip1 UTSW 5 27765206 missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27766284 missense unknown
R5388:Paxip1 UTSW 5 27781455 utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27772004 unclassified probably benign
R5553:Paxip1 UTSW 5 27775639 utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27761618 missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27766173 missense unknown
R6276:Paxip1 UTSW 5 27761668 missense probably damaging 1.00
R6290:Paxip1 UTSW 5 27765578 splice site probably null
R6584:Paxip1 UTSW 5 27758452 missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27744137 missense probably benign 0.18
R6908:Paxip1 UTSW 5 27791224 missense possibly damaging 0.90
R6981:Paxip1 UTSW 5 27765768 nonsense probably null
R7252:Paxip1 UTSW 5 27760086 missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27781420 critical splice donor site probably null
R7585:Paxip1 UTSW 5 27772004 missense unknown
R7665:Paxip1 UTSW 5 27765738 missense unknown
R7926:Paxip1 UTSW 5 27791209 missense unknown
R8169:Paxip1 UTSW 5 27772095 missense unknown
R8335:Paxip1 UTSW 5 27766124 missense unknown
X0066:Paxip1 UTSW 5 27766018 missense unknown
Z1176:Paxip1 UTSW 5 27783729 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTGACTTCTGCCTGTTTAACATG -3'
(R):5'- TGACTCATCCCCTGAAAAGCAG -3'

Sequencing Primer
(F):5'- TAAAGAAATTCACACAAAAATGGGAC -3'
(R):5'- AGCTTGAACTGGGCCCCTG -3'
Posted On2015-10-21