Incidental Mutation 'R4692:Sh3rf1'
ID354974
Institutional Source Beutler Lab
Gene Symbol Sh3rf1
Ensembl Gene ENSMUSG00000031642
Gene NameSH3 domain containing ring finger 1
SynonymsSh3md2, Posh, 2200003J05Rik
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location61223872-61396071 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 61353854 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034060] [ENSMUST00000209611]
Predicted Effect probably null
Transcript: ENSMUST00000034060
SMART Domains Protein: ENSMUSP00000034060
Gene: ENSMUSG00000031642

DomainStartEndE-ValueType
RING 12 52 5.3e-9 SMART
low complexity region 83 90 N/A INTRINSIC
SH3 137 192 1.67e-18 SMART
SH3 199 258 4.84e-15 SMART
low complexity region 366 376 N/A INTRINSIC
low complexity region 397 405 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
SH3 454 511 7.92e-20 SMART
low complexity region 558 569 N/A INTRINSIC
low complexity region 638 651 N/A INTRINSIC
low complexity region 700 734 N/A INTRINSIC
SH3 835 891 1.47e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000209611
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an N-terminus RING-finger, four SH3 domains, and a region implicated in binding of the Rho GTPase Rac. Via the RING-finger, the encoded protein has been shown to function as an ubiquitin-protein ligase involved in protein sorting at the trans-Golgi network. The encoded protein may also act as a scaffold for the c-Jun N-terminal kinase signaling pathway, facilitating the formation of a functional signaling module. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Sh3rf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Sh3rf1 APN 8 61329336 missense probably damaging 1.00
IGL01071:Sh3rf1 APN 8 61225959 missense probably damaging 1.00
IGL01485:Sh3rf1 APN 8 61329331 missense possibly damaging 0.79
IGL01587:Sh3rf1 APN 8 61226058 missense probably damaging 0.99
IGL02412:Sh3rf1 APN 8 61372689 missense probably benign 0.35
IGL02649:Sh3rf1 APN 8 61363191 missense probably damaging 1.00
limpid UTSW 8 61329258 missense probably damaging 1.00
IGL02835:Sh3rf1 UTSW 8 61226047 missense probably damaging 1.00
R0009:Sh3rf1 UTSW 8 61226293 missense probably damaging 0.97
R0016:Sh3rf1 UTSW 8 61374138 missense probably benign 0.18
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0278:Sh3rf1 UTSW 8 61374018 missense probably damaging 1.00
R0395:Sh3rf1 UTSW 8 61393662 splice site probably benign
R0733:Sh3rf1 UTSW 8 61372560 missense probably benign 0.00
R0790:Sh3rf1 UTSW 8 61329258 missense probably damaging 1.00
R1028:Sh3rf1 UTSW 8 61393787 missense possibly damaging 0.94
R1569:Sh3rf1 UTSW 8 61384862 missense probably damaging 1.00
R1654:Sh3rf1 UTSW 8 61361745 missense possibly damaging 0.92
R1799:Sh3rf1 UTSW 8 61372627 missense probably damaging 0.99
R1960:Sh3rf1 UTSW 8 61384863 missense probably damaging 1.00
R2181:Sh3rf1 UTSW 8 61363238 missense probably damaging 0.98
R2184:Sh3rf1 UTSW 8 61372654 missense probably damaging 0.99
R2330:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2331:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2332:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2967:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2994:Sh3rf1 UTSW 8 61372575 missense probably benign 0.10
R3159:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3195:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3196:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3724:Sh3rf1 UTSW 8 61372722 missense probably benign
R4712:Sh3rf1 UTSW 8 61361759 missense probably benign 0.00
R5214:Sh3rf1 UTSW 8 61372731 missense probably damaging 0.98
R5409:Sh3rf1 UTSW 8 61374245 missense probably benign 0.01
R5590:Sh3rf1 UTSW 8 61361732 missense probably benign 0.11
R5651:Sh3rf1 UTSW 8 61363167 missense probably damaging 1.00
R6976:Sh3rf1 UTSW 8 61361732 nonsense probably null
R7126:Sh3rf1 UTSW 8 61349424 missense probably benign 0.01
R7154:Sh3rf1 UTSW 8 61372714 missense possibly damaging 0.89
R7625:Sh3rf1 UTSW 8 61372722 missense probably benign
R7747:Sh3rf1 UTSW 8 61353753 missense probably damaging 0.97
R8217:Sh3rf1 UTSW 8 61329930 missense possibly damaging 0.95
X0066:Sh3rf1 UTSW 8 61226197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTCAGGGTTGGAGAAGAC -3'
(R):5'- AGTTCTCACAGCTTCAGGC -3'

Sequencing Primer
(F):5'- CAGACAGGTAGATGTATTAAAAGCAC -3'
(R):5'- AAAAATTTTGCAGGCTGCTGGC -3'
Posted On2015-10-21