Incidental Mutation 'R4692:Rbl2'
ID354975
Institutional Source Beutler Lab
Gene Symbol Rbl2
Ensembl Gene ENSMUSG00000031666
Gene NameRB transcriptional corepressor like 2
Synonymsp130, Rb2
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location91070057-91123844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91122419 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1084 (D1084E)
Ref Sequence ENSEMBL: ENSMUSP00000147579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000109609] [ENSMUST00000120213] [ENSMUST00000120349] [ENSMUST00000120426] [ENSMUST00000125257] [ENSMUST00000209518] [ENSMUST00000211136]
Predicted Effect probably damaging
Transcript: ENSMUST00000034091
AA Change: D1127E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666
AA Change: D1127E

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109609
SMART Domains Protein: ENSMUSP00000105238
Gene: ENSMUSG00000031667

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120213
SMART Domains Protein: ENSMUSP00000112375
Gene: ENSMUSG00000031667

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120349
SMART Domains Protein: ENSMUSP00000113769
Gene: ENSMUSG00000031667

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120426
SMART Domains Protein: ENSMUSP00000113379
Gene: ENSMUSG00000031667

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125257
SMART Domains Protein: ENSMUSP00000119277
Gene: ENSMUSG00000031667

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209518
AA Change: D1117E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210426
Predicted Effect probably benign
Transcript: ENSMUST00000211050
Predicted Effect probably damaging
Transcript: ENSMUST00000211136
AA Change: D1084E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice generally show no overt phenotype. Homozygotes for a null allele show strain-dependent embryonic lethality and growth arrest associated with altered apoptosis and cell proliferation, impaired neurogenesis and myogenesis, failed embryo turning and heart looping, and thin myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Rbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rbl2 APN 8 91085445 missense probably damaging 1.00
IGL01084:Rbl2 APN 8 91122313 missense probably damaging 0.99
IGL01317:Rbl2 APN 8 91100057 missense probably damaging 1.00
IGL01637:Rbl2 APN 8 91106438 missense probably benign
IGL01843:Rbl2 APN 8 91090216 missense probably benign 0.11
IGL01884:Rbl2 APN 8 91096836 missense probably damaging 1.00
IGL02071:Rbl2 APN 8 91102198 missense probably damaging 1.00
IGL02588:Rbl2 APN 8 91087084 missense probably damaging 0.99
IGL03027:Rbl2 APN 8 91078906 missense possibly damaging 0.92
IGL03162:Rbl2 APN 8 91085702 missense probably benign 0.01
IGL03200:Rbl2 APN 8 91096767 missense probably benign 0.00
R0165:Rbl2 UTSW 8 91074176 missense probably damaging 1.00
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0317:Rbl2 UTSW 8 91087144 missense probably benign 0.00
R0539:Rbl2 UTSW 8 91112505 splice site probably benign
R1532:Rbl2 UTSW 8 91106417 missense probably benign 0.01
R1696:Rbl2 UTSW 8 91085724 missense probably benign 0.12
R1852:Rbl2 UTSW 8 91095563 missense possibly damaging 0.84
R1866:Rbl2 UTSW 8 91112529 missense probably benign 0.00
R1975:Rbl2 UTSW 8 91085462 missense probably benign
R2062:Rbl2 UTSW 8 91106739 missense probably damaging 1.00
R2180:Rbl2 UTSW 8 91090055 missense possibly damaging 0.51
R2423:Rbl2 UTSW 8 91087146 missense probably benign 0.34
R3109:Rbl2 UTSW 8 91102235 missense probably benign
R4356:Rbl2 UTSW 8 91107107 missense probably damaging 0.97
R4707:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R4784:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R5084:Rbl2 UTSW 8 91115131 missense probably benign 0.43
R5432:Rbl2 UTSW 8 91102283 missense probably benign 0.01
R5493:Rbl2 UTSW 8 91115819 missense probably damaging 1.00
R5546:Rbl2 UTSW 8 91078932 missense probably benign 0.00
R5918:Rbl2 UTSW 8 91090130 missense probably benign 0.02
R6186:Rbl2 UTSW 8 91106730 missense probably damaging 1.00
R6257:Rbl2 UTSW 8 91115678 missense probably damaging 1.00
R6526:Rbl2 UTSW 8 91096839 missense probably benign 0.04
R6546:Rbl2 UTSW 8 91070370 missense probably benign
R6714:Rbl2 UTSW 8 91106787 missense possibly damaging 0.91
R7214:Rbl2 UTSW 8 91083429 critical splice donor site probably null
R7286:Rbl2 UTSW 8 91102294 nonsense probably null
R7290:Rbl2 UTSW 8 91115041 missense probably benign 0.33
R7315:Rbl2 UTSW 8 91076012 missense probably damaging 0.96
R7524:Rbl2 UTSW 8 91115193 missense probably benign
R8060:Rbl2 UTSW 8 91096869 critical splice donor site probably null
R8071:Rbl2 UTSW 8 91113989 missense probably damaging 1.00
R8154:Rbl2 UTSW 8 91107197 missense probably damaging 1.00
R8302:Rbl2 UTSW 8 91085445 missense probably damaging 1.00
R8344:Rbl2 UTSW 8 91115759 missense possibly damaging 0.89
X0023:Rbl2 UTSW 8 91090079 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCCTACTGAGCATTTCCAGG -3'
(R):5'- GAGCCGTGTTGAAGGTAAGC -3'

Sequencing Primer
(F):5'- ACTGAGCATTTCCAGGTTTTTCTAAC -3'
(R):5'- AAGTTGCCCTCAGACATGCTG -3'
Posted On2015-10-21